MSTUD0114

MISSION^® Synthetic microRNA Inhibitor, Mouse

mmu-miR-199a-5p

• NACRES: NA.51
• UNSPSC Code: 41105324

Eigenschaften

• Quality Level: 100
• product line: MISSION^®
• form: solid
• mature sequence: CCCAGUGUUCAGACUACCUGUUC
• Sanger mature/minor accession no.: MIMAT0000229
• microRNA accession no.: MI0000713
• storage temp.: −20°C

Beschreibung

General description

Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.[1] This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.

The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.

• Long lasting inhibition at very low dosage
• Excellent resistance to cellular nucleases
• Custom synthesis available for a variety of species

Two negative controls are available: Arabidopsis thaliana sequence (NCSTUD001) and Caenorhabditis elegans sequence (NCSTUD002)

Other Notes

Based on miRBase V19

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Sicherheitshinweise

• pictograms: GHS08
• signalword: Warning
• hcodes: H373
• pcodes: P260 - P314 - P501
• Hazard Classifications: STOT RE 2 Inhalation
• target_organs: Respiratory Tract
• Lagerklasse: 11 - Combustible Solids
• wgk: WGK 3
• flash_point_f: Not applicable
• flash_point_c: Not applicable