Anmelden zur Ansicht der Organisations- und Vertragspreise.
Größe auswählen
Ansicht ändern
Über diesen Artikel
NACRES:
NA.51
UNSPSC Code:
41105324
Technischer Dienst
Benötigen Sie Hilfe? Unser Team von erfahrenen Wissenschaftlern ist für Sie da.
Unterstützung erhaltendescription
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
ACGTCCATCGAGGACTTCAGCGAAGTGTACTTGGTGACCACCCTGATGGGCGCCGACCTGAACAACATCGTCAAGTGCCAGGCGCTGAGCGACGAGCACGTTCAATTCCTGGTTTACCAGCTGCTGCGCGGGCTGAAGTACATCCACTCGGCCGGGATCATCCACCGGGACCTGAAGCCCAGCAACGTGGCTGTGAACGAGGACTGTGAGCTCAGGATCCTGGATTTTGGGCTGGCGCGCCAGGCGGACGAGGAGATGACCGGCTATGTGGCCACGCGCTGGTACCGGGCACCTGAGATCATGCTCAACTGGATGCATTACAACCAAACAGTGGATATCTGGTCCGTGGGCTGCATCATGGCTGAGCTGCTCCAGGGCAAGGCCCTCTTCCCGGGAAGCGACTACATTGACCAGCTGAAGCG
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... MAPK11(5600)
General description
MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Lagerklasse
10 - Combustible liquids
flash_point_f
Not applicable
flash_point_c
Not applicable
Hier finden Sie alle aktuellen Versionen:
Besitzen Sie dieses Produkt bereits?
In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.
Xiaoyu Zhang et al.
Antiviral research, 167, 68-77 (2019-04-07)
Lassa virus (LASV) causes Lassa hemorrhagic fever in humans and poses a significant threat to public health in West Africa. Current therapeutic treatments for Lassa fever are limited, making the development of novel countermeasures an urgent priority. In this study
A J Browne et al.
Cell death & disease, 7, e2119-e2119 (2016-02-26)
The Wnt inhibitor Dickkopf-1 (DKK-1) has been associated with the occurrence of bone metastases in osteotropic prostate cancer by inhibiting osteoblastogenesis. P38 mitogen-activated protein kinase (MAPK) activity is also dysregulated in advanced prostate cancer. However, the impact of p38 MAPK
Global Trade Item Number
| SKU | GTIN |
|---|---|
| EHU094331-20UG | 04061831356359 |
| EHU094331-50UG | 04061828363919 |