Direkt zum Inhalt
Merck

EHU002141

Sigma-Aldrich

MISSION® esiRNA

targeting human MAP2K1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCTTGAGGCCTTTCTTACCCAGAAGCAGAAGGTGGGAGAACTGAAGGATGACGACTTTGAGAAGATCAGTGAGCTGGGGGCTGGCAATGGCGGTGTGGTGTTCAAGGTCTCCCACAAGCCTTCTGGCCTGGTCATGGCCAGAAAGCTAATTCATCTGGAGATCAAACCCGCAATCCGGAACCAGATCATAAGGGAGCTGCAGGTTCTGCATGAGTGCAACTCTCCGTACATCGTGGGCTTCTATGGTGCGTTCTACAGCGATGGCGAGATCAGTATCTGCATGGAGCACATGGATGGAGGTTCTCTGGATCAAGTCCTGAAGAAAGCTGGAAGAATTCCTGAACAAATTTTAGGAAAAGTTAGCATTGCTGTAATAAAAGGCCTGACATATCTGAGGGAGAAGCACAAGATCATGCACAGAGATGTCAAGCCCTCCAACAT

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Weiran Liu et al.
Oncotarget, 8(1), 179-190 (2016-06-23)
As shortened telomeres inhibit tumor formation and prolong life span in a KrasG12D mouse lung cancer model, we investigated the implications of telomerase in Kras-mutant NSCLC. We found that Kras mutations increased TERT (telomerase reverse transcriptase) mRNA expression and telomerase
Ching-Ting Wei et al.
Anticancer research, 39(2), 695-701 (2019-02-04)
Sorafenib is now standard treatment for advanced hepatocellular carcinoma (HCC). However, therapeutic efficacy is not as good as was predicted. Many efforts are being made to improve HCC sensitivity to sorafenib. Our previous study demonstrated that co-treatment with chrysin enhanced
Zhongsheng Liu et al.
Cell biochemistry and function, 38(1), 87-96 (2019-11-02)
Uncarboxylated osteocalcin (unOc) is an osteoblast-derived hormone with multiple regulatory functions. Osteocalcin knockdown delays the maturation of mineral species and downregulates the expression of osteogenic-specific genes in human mesenchymal stromal cells. However, the underlying mechanisms remain unclear. Here, we investigated
Yiqun Huang et al.
Oncology reports, 41(1), 377-386 (2018-10-27)
MAPK kinase 1 (MEK1) is an upstream protein kinase of extracellular signal regulated kinase (ERK), which activates the ERK/MAPK (mitogen activated protein kinase) pathway. Importantly, bioinformatic analysis has shown that there is a target complementary binding site between miR‑101 and MEK1.
Kyle M Kovary et al.
Molecular systems biology, 14(5), e7997-e7997 (2018-05-16)
Due to noise in the synthesis and degradation of proteins, the concentrations of individual vertebrate signaling proteins were estimated to vary with a coefficient of variation (CV) of approximately 25% between cells. Such high variation is beneficial for population-level regulation

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.