Ugrás a tartalomra
Merck
Összes fotó(1)

Fontos dokumentumok

EHU122051

Sigma-Aldrich

MISSION® esiRNA

targeting human STAT3

Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez
Összes fotó(1)

About This Item

UNSPSC kód:
41105324
NACRES:
NA.51

leírás

Powered by Eupheria Biotech

Minőségi szint

100

termékcsalád

MISSION®

form

lyophilized powder

esiRNS cDNS célszekvencia

GGCCATCTTGAGCACTAAGCCTCCAGGCACCTTCCTGCTAAGATTCAGTGAAAGCAGCAAAGAAGGAGGCGTCACTTTCACTTGGGTGGAGAAGGACATCAGCGGTAAGACCCAGATCCAGTCCGTGGAACCATACACAAAGCAGCAGCTGAACAACATGTCATTTGCTGAAATCATCATGGGCTATAAGATCATGGATGCTACCAATATCCTGGTGTCTCCACTGGTCTATCTCTATCCTGACATTCCCAAGGAGGAGGCATTCGGAAAGTATTGTCGGCCAGAGAGCCAGGAGCATCCTGAAGCTGACCCAGGTAGCGCTGCCCCATACCTGAAGACCAAGTTTATCTGTGTGACACCAACGACCTGCAGCAATACCATTGACCTGCCGATGTCCCCCCGCACTTTAGATTCATTGATGCAGTTTGGAAATAATGGTGAAGGTGCTGAACC

Ensembl | humán elérési szám

ENSG00000168610

NCBI elérési szám

NM_003150

kiszállítva

ambient

tárolási hőmérséklet

−20°C

Géninformáció

human ... STAT3(6774) , STAT3(6774)

Általános leírás

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Jogi információk

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Nem találja a megfelelő terméket?  

Próbálja ki a Termékválasztó eszköz. eszközt

Tárolási osztály kódja

10 - Combustible liquids

Lobbanási pont (F)

Not applicable

Lobbanási pont (C)

Not applicable

Analitikai tanúsítványok (COA)

Analitikai tanúsítványok (COA) keresése a termék sarzs-/tételszámának megadásával. A sarzs- és tételszámok a termék címkéjén találhatók, a „Lot” vagy „Batch” szavak után.

Már rendelkezik ezzel a termékkel?

Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.

Dokumentumtár megtekintése

Jong Hyun Lee et al.
Journal of advanced research, 26, 83-94 (2020-11-03)
Epithelial-mesenchymal transition (EMT) is a process of transdifferentiation where epithelial cells attain mesenchymal phenotype to gain invasive properties and thus, can contribute to metastasis of tumor cells. The antimetastatic and antitumor efficacy of brusatol (BT) was investigated in a hepatocellular
Chengyang Wang et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 43(2), 743-756 (2017-09-28)
To evaluate the effect of Liuweibuqi capsules on chronic obstructive pulmonary disease (COPD) through the JAK/STAT pathway. Lung function was measured with a spirometer. Changes in lung histology were observed using H&E staining. Cigarette smoke extract combined with lipopolysaccharide (CSE+LPS)
Young Yun Jung et al.
Frontiers in pharmacology, 9, 531-531 (2018-06-15)
Because of the essential role of signal transducer and activator of transcription 3 (STAT3) in proliferation, anti-apoptosis, and chemoresistance of multiple myeloma (MM), we investigated whether icariin, a prenylated flavonol glycoside, inhibits both constitutive and inducible STAT3 activation in human
M Bam et al.
Translational psychiatry, 7(8), e1222-e1222 (2017-08-30)
Chronic inflammation is a characteristic of post-traumatic stress disorder (PTSD). The initiation of inflammation and molecules involved are not yet clearly understood. Here, we provide compelling evidence that the inflammation seen in PTSD may result from the dysregulated miRNA processing
Purushottam Lamichhane et al.
Cancer research, 77(23), 6667-6678 (2017-10-11)
Ligation of programmed cell death-1 (PD-1) in the tumor microenvironment is known to inhibit effective adaptive antitumor immunity. Blockade of PD-1 in humans has resulted in impressive, durable regression responses in select tumor types. However, durable responses have been elusive
View All Related Papers

Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.

Lépjen kapcsolatba a szaktanácsadással