Ugrás a tartalomra
Merck

EHU008751

Sigma-Aldrich

MISSION® esiRNA

targeting human EPAS1

Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez


About This Item

UNSPSC kód:
41105324
NACRES:
NA.51

leírás

Powered by Eupheria Biotech

Minőségi szint

termékcsalád

MISSION®

Forma

lyophilized powder

esiRNS cDNS célszekvencia

GGGCCAGGTGAAAGTCTACAACAACTGCCCTCCTCACAATAGTCTGTGTGGCTACAAGGAGCCCCTGCTGTCCTGCCTCATCATCATGTGTGAACCAATCCAGCACCCATCCCACATGGACATCCCCCTGGATAGCAAGACCTTCCTGAGCCGCCACAGCATGGACATGAAGTTCACCTACTGTGATGACAGAATCACAGAACTGATTGGTTACCACCCTGAGGAGCTGCTTGGCCGCTCAGCCTATGAATTCTACCATGCGCTAGACTCCGAGAACATGACCAAGAGTCACCAGAACTTGTGCACCAAGGGTCAGGTAGTAAGTGGCCAGTACCGGATGCTCGCAAAGCATGGGGGCTACGTGTGGCTGGAGACCCAGGGGACGGTCATCTACAACCCTCGCAACCTGCAGCCCCAGTGCATCATGTGTGTCA

Ensembl | humán elérési szám

NCBI elérési szám

kiszállítva

ambient

tárolási hőmérséklet

−20°C

Géninformáció

Általános leírás

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Jogi információk

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Tárolási osztály kódja

10 - Combustible liquids

Lobbanási pont (F)

Not applicable

Lobbanási pont (C)

Not applicable


Válasszon a legfrissebb verziók közül:

Analitikai tanúsítványok (COA)

Lot/Batch Number

Nem találja a megfelelő verziót?

Ha egy adott verzióra van szüksége, a tétel- vagy cikkszám alapján rákereshet egy adott tanúsítványra.

Már rendelkezik ezzel a termékkel?

Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.

Dokumentumtár megtekintése

Seungyeul Yoo et al.
PLoS genetics, 11(1), e1004898-e1004898 (2015-01-09)
Chronic Obstructive Pulmonary Disease (COPD) is a complex disease. Genetic, epigenetic, and environmental factors are known to contribute to COPD risk and disease progression. Therefore we developed a systematic approach to identify key regulators of COPD that integrates genome-wide DNA
Kei Houri et al.
Scientific reports, 10(1), 3735-3735 (2020-03-01)
Elevation of the levels of reactive oxygen species (ROS) is a major tissue-degenerative phenomenon involved in aging and aging-related diseases. The detailed mechanisms underlying aging-related ROS generation remain unclear. Presently, the expression of microRNA (miR)-142-5p was significantly upregulated in bone
Farhadul Islam et al.
Frontiers in oncology, 10, 1534-1534 (2020-10-13)
Endothelial PAS domain-containing protein 1 (EPAS1) is an angiogenic factor and its implications have been reported in many cancers but not in esophageal squamous cell carcinoma (ESCC). Herein, we aim to examine the genetic and molecular alterations, clinical implications, and
Olga Roche et al.
Nucleic acids research, 44(19), 9315-9330 (2016-11-02)
A wide range of diseases course with an unbalance between the consumption of oxygen by tissues and its supply. This situation triggers a transcriptional response, mediated by the hypoxia inducible factors (HIFs), that aims to restore oxygen homeostasis. Little is
Shirley Dehn et al.
Journal of immunology (Baltimore, Md. : 1950), 197(9), 3639-3649 (2016-09-28)
Hypoxia-inducible factor (HIF)-α isoforms regulate key macrophage (MΦ) functions during ischemic inflammation. HIF-2α drives proinflammatory cytokine production; however, the requirements for HIF-2α during other key MΦ functions, including phagocytosis, are unknown. In contrast to HIF-1α, HIF-2α was not required for

Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.

Lépjen kapcsolatba a szaktanácsadással