Ugrás a tartalomra
Merck
Összes fotó(1)

Fontos dokumentumok

EHU033071

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK6

Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez


About This Item

UNSPSC kód:
41105324
NACRES:
NA.51

leírás

Powered by Eupheria Biotech

Minőségi szint

termékcsalád

MISSION®

Forma

lyophilized powder

esiRNS cDNS célszekvencia

TGTTTCAGCTTCTCCGAGGTCTGGACTTTCTTCATTCACACCGAGTAGTGCATCGCGATCTAAAACCACAGAACATTCTGGTGACCAGCAGCGGACAAATAAAACTCGCTGACTTCGGCCTTGCCCGCATCTATAGTTTCCAGATGGCTCTAACCTCAGTGGTCGTCACGCTGTGGTACAGAGCACCCGAAGTCTTGCTCCAGTCCAGCTACGCCACCCCCGTGGATCTCTGGAGTGTTGGCTGCATATTTGCAGAAATGTTTCGTAGAAAGCCTCTTTTTCGTGGAAGTTCAGATGTTGATCAACTAGGAAAAATCTTGGACGTGATTGGACTCCCAGGAGAAGAAGACTGGCCTAGAGATGTTGCCCTTCCCAGGCAGGCTTTTCATTCAAAATCTGCCCAACCAATTGAG

Ensembl | humán elérési szám

NCBI elérési szám

kiszállítva

ambient

tárolási hőmérséklet

−20°C

Géninformáció

Általános leírás

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Jogi információk

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Nem találja a megfelelő terméket?  

Próbálja ki a Termékválasztó eszköz. eszközt

Tárolási osztály kódja

10 - Combustible liquids

Lobbanási pont (F)

Not applicable

Lobbanási pont (C)

Not applicable


Válasszon a legfrissebb verziók közül:

Analitikai tanúsítványok (COA)

Lot/Batch Number

Nem találja a megfelelő verziót?

Ha egy adott verzióra van szüksége, a tétel- vagy cikkszám alapján rákereshet egy adott tanúsítványra.

Már rendelkezik ezzel a termékkel?

Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.

Dokumentumtár megtekintése

Míriam Tarrado-Castellarnau et al.
Molecular systems biology, 13(10), 940-940 (2017-10-06)
Cyclin-dependent kinases (CDK) are rational cancer therapeutic targets fraught with the development of acquired resistance by tumor cells. Through metabolic and transcriptomic analyses, we show that the inhibition of CDK4/6 leads to a metabolic reprogramming associated with gene networks orchestrated
Xuefeng Pan et al.
Molecular therapy. Nucleic acids, 22, 38-49 (2020-09-11)
Emerging studies indicate that long noncoding RNAs (lncRNAs) play crucial roles in ovarian cancer (OC). By analyzing high-throughput data, we found that SNHG17 was highly expressed in multiple OC cohorts. However, its functions in OC were not explored. In this
Tao Gong et al.
Aging, 12(12), 12086-12106 (2020-06-26)
Emerging studies indicate that long non-coding RNAs (lncRNAs) play crucial roles in colorectal cancer (CRC). Here, we reported lncRNA CASC21, which is induced by FOXP1, functions as an oncogene in CRC. We systematically elucidated its clinical significance and possible molecular
Lihua Guo et al.
Journal of B.U.ON. : official journal of the Balkan Union of Oncology, 23(3), 787-794 (2018-07-14)
Clear cell renal cell carcinoma (ccRCC) accounts for 70-80% of renal cell carcinomas. Various microRNAs (miRs) have been reported to affect the tumorigenesis of ccRCC. However, the role of miR-384 in ccRCC is still unknown. Thus, the purpose of this
Tongzheng Liu et al.
Nature communications, 8, 13923-13923 (2017-01-10)
Tumour metastasis, the spread of cancer cells from the original tumour site followed by growth of secondary tumours at distant organs, is the primary cause of cancer-related deaths and remains poorly understood. Here we demonstrate that inhibition of CDK4/6 blocks

Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.

Lépjen kapcsolatba a szaktanácsadással