Ugrás a tartalomra
Merck
Összes fotó(1)

Fontos dokumentumok

EHU059261

Sigma-Aldrich

MISSION® esiRNA

targeting human TFEB

Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez


About This Item

UNSPSC kód:
41105324
NACRES:
NA.51

leírás

Powered by Eupheria Biotech

Minőségi szint

termékcsalád

MISSION®

form

lyophilized powder

esiRNS cDNS célszekvencia

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Ensembl | humán elérési szám

NCBI elérési szám

kiszállítva

ambient

tárolási hőmérséklet

−20°C

Géninformáció

Általános leírás

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Jogi információk

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Nem találja a megfelelő terméket?  

Próbálja ki a Termékválasztó eszköz. eszközt

Tárolási osztály kódja

10 - Combustible liquids

Lobbanási pont (F)

Not applicable

Lobbanási pont (C)

Not applicable


Analitikai tanúsítványok (COA)

Analitikai tanúsítványok (COA) keresése a termék sarzs-/tételszámának megadásával. A sarzs- és tételszámok a termék címkéjén találhatók, a „Lot” vagy „Batch” szavak után.

Már rendelkezik ezzel a termékkel?

Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.

Dokumentumtár megtekintése

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However
Xingchen Zhao et al.
The Journal of pathology, 245(2), 235-248 (2018-03-24)
Insufficient autophagy in podocytes is related to podocyte injury in diabetic nephropathy (DN). Advanced glycation end-products (AGEs) are major factors of podocyte injury in DN. However, the role and mechanism of AGEs in autophagic dysfunction remain unknown. We investigated autophagic
Muzo Wu et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L138-L153 (2017-04-15)
Downregulation of the alveolar macrophage (AM) receptor with collagenous structure (MARCO) leads to susceptibility to postinfluenza bacterial pneumonia, a major cause of morbidity and mortality. We sought to determine whether immunomodulation of MARCO could improve host defense and resistance to
Raquel Parra-Millán et al.
mSphere, 3(2) (2018-03-31)
Acinetobacter baumannii is a significant human pathogen associated with hospital-acquired infections. While adhesion, an initial and important step in A. baumannii infection, is well characterized, the intracellular trafficking of this pathogen inside host cells remains poorly studied. Here, we demonstrate that
Li He et al.
Journal of leukocyte biology, 100(5), 1113-1124 (2016-11-02)
Macrophage dysfunction in obesity and diabetes is associated with persistent inflammation and poor wound healing responses. Relevant to these phenotypes, we have previously shown that macrophage activation in a high-fat environment results in cell death via a mechanism that involves

Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.

Lépjen kapcsolatba a szaktanácsadással