Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EMU184491

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gapdh

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TCAAGAAGGTGGTGAAGCAGGCATCTGAGGGCCCACTGAAGGGCATCTTGGGCTACACTGAGGACCAGGTTGTCTCCTGCGACTTCAACAGCAACTCCCACTCTTCCACCTTCGATGCCGGGGCTGGCATTGCTCTCAATGACAACTTTGTCAAGCTCATTTCCTGGTATGACAATGAATACGGCTACAGCAACAGGGTGGTGGACCTCATGGCCTACATGGCCTCCAAGGAGTAAGAAACCCTGGACCACCCACCCCAGCAAGGACACTGAGCAAGAGAGGCCCTATCCCAACTCGGCCCCCAACACTGAGCATCTCCCTCACAATTTCCATCCCAGACCCCCATAATAACAGGAGGGGCCTAGGGAGCCCTCCCTACTCTCTTGAATACCATCAATAAAGTTCGCTGC

Ensembl | Número de adesão de camundongo

ENSMUSG00000057666

nº de adesão NCBI

NM_008084

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

mouse ... GAPDH(100042025) , Gapdh(14433)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Feifei Feng et al.
Environmental health perspectives, 120(12), 1692-1698 (2012-09-27)
The role of the Nlrp3 inflammasome in nonallergic airway hyperresponsiveness (AHR) has not previously been reported. Recent evidence supports both interleukin (IL) 1β and short fragments of hyaluronan (HA) as contributors to the biological response to inhaled ozone. Because extracellular
Laurence Booth et al.
Molecular cancer therapeutics, 13(10), 2384-2398 (2014-08-12)
The present studies examined the toxic interaction between the non-coxib celecoxib derivative OSU-03012 and phosphodiesterase 5 (PDE5) inhibitors, and also determined the roles of endoplasmic reticulum stress response regulators in cell survival. PDE5 inhibitors interacted in a greater than additive
Danielle Bartlett et al.
PloS one, 10(4), e0124154-e0124154 (2015-04-17)
Melanoma is a highly aggressive and drug resistant form of skin cancer. It arises from melanocytes, the pigment producing cells of the skin. The formation of these melanocytes is driven by the transcription factor PAX3 early during embryonic development. As
Shlomit Farkash-Amar et al.
PLoS genetics, 10(3), e1004176-e1004176 (2014-03-08)
To understand gene function, genetic analysis uses large perturbations such as gene deletion, knockdown or over-expression. Large perturbations have drawbacks: they move the cell far from its normal working point, and can thus be masked by off-target effects or compensation
Antonella Izzo et al.
Human molecular genetics, 23(16), 4406-4419 (2014-04-05)
Mitochondrial dysfunction, which is consistently observed in Down syndrome (DS) cells and tissues, might contribute to the severity of the DS phenotype. Our recent studies on DS fetal hearts and fibroblasts have suggested that one of the possible causes of
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica