Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU113061

Sigma-Aldrich

MISSION® esiRNA

targeting human UBE3A

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TCTGCTGCTGCTATGGAAGAAGACTCAGAAGCATCTTCCTCAAGGATAGGTGATAGCTCACAGGGAGACAACAATTTGCAAAAATTAGGCCCTGATGATGTGTCTGTGGATATTGATGCCATTAGAAGGGTCTACACCAGATTGCTCTCTAATGAAAAAATTGAAACTGCCTTTCTCAATGCACTTGTATATTTGTCACCTAACGTGGAATGTGACTTGACGTATCACAATGTATACTCTCGAGATCCTAATTATCTGAATTTGTTCATTATCGTAATGGAGAATAGAAATCTCCACAGTCCTGAATATCTGGAAATGGCTTTGCCATTATTTTGCAAAGCGATGAGCAAGCTACCCCTTGCAGCCCAAGGAAAACTGATCAGACTGTGGTCTAAATACAATGCAGACCAGATTCGGAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000114062

numer dostępu NCBI

NM_130838

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... UBE3A(7337) , UBE3A(7337)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Fei Zhang et al.
Journal of orthopaedic surgery and research, 12(1), 103-103 (2017-07-07)
Osteosarcoma (OS) is one of the most common malignant tumors developed in the bone. EZH2 has been found to play pivotal roles in the development of various cancers. LncRNA-ANCR (anti-differentiation ncRNA) has been reported to interact with EZH2 and regulated
Yanfei Li et al.
Acta biochimica et biophysica Sinica, 52(1), 58-63 (2019-11-05)
Cardiac hypertrophy is considered to be a leading factor in heart function-related deaths. In this study, we explored the potential mechanism underlying cardiac hypertrophy induced by isoproterenol. Our results showed that isoproterenol induced cardiac hypertrophy in AC16 cells, as reflected
Imran Jamal et al.
Neurobiology of disease, 105, 99-108 (2017-06-04)
Angelman syndrome (AS) is a neurodevelopmental disorder characterized by severe intellectual and developmental disabilities. The disease is caused by the loss of function of maternally inherited UBE3A, a gene that exhibits paternal-specific imprinting in neuronal tissues. Ube3a-maternal deficient mice (AS
Tsubasa Munakata et al.
PLoS pathogens, 3(9), 1335-1347 (2007-10-03)
Hepatitis C virus (HCV) is a positive-strand RNA virus that frequently causes persistent infections and is uniquely associated with the development of hepatocellular carcinoma. While the mechanism(s) by which the virus promotes cancer are poorly defined, previous studies indicate that
Dohun Pyeon et al.
Viruses, 11(12) (2019-12-01)
Molecular basis of HIV-1 life cycle regulation has thus far focused on viral gene stage-specificity, despite the quintessence of post-function protein elimination processes in the virus life cycle and consequent pathogenesis. Our studies demonstrated that a key pathogenic HIV-1 viral
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej