Direkt zum Inhalt
Merck

EHU155151

Sigma-Aldrich

MISSION® esiRNA

targeting human EP300

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATACCGAACCAAAGCCCTCTTTGCCTTTGAAGAAATTGATGGTGTTGACCTGTGCTTCTTTGGCATGCATGTTCAAGAGTATGGCTCTGACTGCCCTCCACCCAACCAGAGGAGAGTATACATATCTTACCTCGATAGTGTTCATTTCTTCCGTCCTAAATGCTTGAGGACTGCAGTCTATCATGAAATCCTAATTGGATATTTAGAATATGTCAAGAAATTAGGTTACACAACAGGGCATATTTGGGCATGTCCACCAAGTGAGGGAGATGATTATATCTTCCATTGCCATCCTCCTGACCAGAAGATACCCAAGCCCAAGCGACTGCAGGAATGGTACAAAAAAATGCTTGACAAGGCTGTATCAGAGCGTATTGTCCATGACTACAAGGATATTTTTAAACAAGCTACTGAAGATAGATTAACAAGTGCAAAGGAATTGCCTTATTTCGAGGGTGATTTCTGGCCCAATGTTCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Jia Tao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 106, 1727-1733 (2018-08-19)
Pulmonary fibrosis is strongly correlated with inflammation factors, cytokine, and collagen secretion, whereby discoidin domain receptor 1 (DDR1) signaling plays an important role. EP300 is defined as an acetyltransferase that can acetylate histone and has been broadly studied in several
Mizuo Ando et al.
Nature communications, 10(1), 2188-2188 (2019-05-18)
Although promoter-associated CpG islands have been established as targets of DNA methylation changes in cancer, previous studies suggest that epigenetic dysregulation outside the promoter region may be more closely associated with transcriptional changes. Here we examine DNA methylation, chromatin marks
Alexander Ring et al.
BMC cancer, 20(1), 1076-1076 (2020-11-11)
Triple negative breast cancer (TNBC) is an aggressive breast cancer subtype with basal features, lacking the expression of receptors targeted successfully in other breast cancer subtypes. Treatment response to adjuvant and neoadjuvant chemotherapy is often short-lived and metastatic spread occurs
Howard E Boudreau et al.
Oncotarget, 8(27), 44379-44397 (2017-06-03)
Previously, we showed wild-type (WT) and mutant (mut) p53 differentially regulate reactive oxygen species (ROS) generation by NADPH oxidase-4 (NOX4): p53-WT suppresses TGFβ-induced NOX4, ROS and cell migration, whereas tumor-associated mut-p53 proteins enhance NOX4 expression and cell migration. Here, we
Karen Dendoncker et al.
Proceedings of the National Academy of Sciences of the United States of America, 116(26), 12942-12951 (2019-06-12)
Glucocorticoid resistance (GCR) is defined as an unresponsiveness to the therapeutic effects, including the antiinflammatory ones of glucocorticoids (GCs) and their receptor, the glucocorticoid receptor (GR). It is a problem in the management of inflammatory diseases and can be congenital

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.