Direkt zum Inhalt
Merck

EHU068001

Sigma-Aldrich

MISSION® esiRNA

targeting human NR3C1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

CCCTACCCTGGTGTCACTGTTGGAGGTTATTGAACCTGAAGTGTTATATGCAGGATATGATAGCTCTGTTCCAGACTCAACTTGGAGGATCATGACTACGCTCAACATGTTAGGAGGGCGGCAAGTGATTGCAGCAGTGAAATGGGCAAAGGCAATACCAGGTTTCAGGAACTTACACCTGGATGACCAAATGACCCTACTGCAGTACTCCTGGATGTTTCTTATGGCATTTGCTCTGGGGTGGAGATCATATAGACAATCAAGTGCAAACCTGCTGTGTTTTGCTCCTGATCTGATTATTAATGAGCAGAGAATGACTCTACCCTGCATGTACGACCAATGTAAACACATGCTGTATGTTTCCTCTGAGTTACACAGGCTTCAGGTATCTTATGAAGAGTATCTCTGTATGAAAACCTTACTGCTTCTCTCTTCAGTTCCTAAGGACGGTCTGAAGAGCC

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Samaresh Sau et al.
Molecular and cellular biochemistry, 436(1-2), 119-136 (2017-06-07)
Glucocorticoid, such as dexamethasone (Dex) is often used along with chemotherapy to antagonize side effects of chemotherapy. However, sustained use of Dex frequently develops drug resistance in patients. As a strategy to re-induce drug sensitivity, we planned to modify Dex
Benjamin Small et al.
The Journal of clinical endocrinology and metabolism, 105(3) (2019-10-31)
The selective progesterone modulator ulipristal acetate (ulipristal) offers a much-needed therapeutic option for the clinical management of uterine fibroids. Although ulipristal initially passed safety evaluations in Europe, postmarketing analysis identified cases of hepatic injury and failure, leading to restrictions on
Tetsuya Homma et al.
Medicina (Kaunas, Lithuania), 56(3) (2020-03-04)
Viral infection is the main cause of asthma and COPD (chronic obstructive pulmonary disease) exacerbation and accumulate inflammatory cells to airway tissue. We have reported poly I:C, a mimic product of the virus and ligand of toll-like receptor 3 (TLR3)
Weiping Qin et al.
Biochemical and biophysical research communications, 450(2), 979-983 (2014-06-28)
Glucocorticoids stimulate muscle atrophy through a cascade of signals that includes activation of FoxO transcription factors which then upregulate multiple genes to promote degradation of myofibrillar and other muscle proteins and inhibit protein synthesis. Our previous finding that glucocorticoids upregulate

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.