Wszystkie zdjęcia(1)
Kluczowe dokumenty
HMI0001
MISSION® microRNA Mimic
hsa-let-7a
Synonim(y):
Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU, hsa-let-7a-5p
Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
About This Item
Polecane produkty
linia produktu
MISSION®
Formularz
solid
numer dostępu Sanger dla cząsteczek dojrzałych/niedojrzałych
numer dostępu Sanger microRNA
temp. przechowywania
−20°C
informacje o genach
Opis ogólny
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Inne uwagi
miRBase V18 Mature ID update: hsa-let-7a-5p
Informacje prawne
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.
Kod klasy składowania
11 - Combustible Solids
Klasa zagrożenia wodnego (WGK)
WGK 3
Temperatura zapłonu (°F)
Not applicable
Temperatura zapłonu (°C)
Not applicable
Wybierz jedną z najnowszych wersji:
Certyfikaty analizy (CoA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Dokumenty section.
Proszę o kontakt, jeśli potrzebna jest pomoc Obsługa Klienta
Masz już ten produkt?
Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.
Shubhangini Kataruka et al.
Nucleic acids research, 48(14), 8050-8062 (2020-07-02)
MicroRNAs (miRNAs) are ubiquitous small RNAs guiding post-transcriptional gene repression in countless biological processes. However, the miRNA pathway in mouse oocytes appears inactive and dispensable for development. We propose that marginalization of the miRNA pathway activity stems from the constraints
Active Filters
Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.
Skontaktuj się z zespołem ds. pomocy technicznej
