Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU157921

Sigma-Aldrich

MISSION® esiRNA

targeting human TFE3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGAGGCTGCCCACACTACCGGCCCCACAGGCAGTGCGCCCAACAGCCCCATGGCGCTGCTCACCATCGGGTCCAGCTCAGAGAAGGAGATTGATGATGTCATTGATGAGATCATCAGCCTGGAGTCCAGTTACAATGATGAAATGCTCAGCTATCTGCCCGGAGGCACCACAGGACTGCAGCTCCCCAGCACGCTGCCTGTGTCAGGGAATCTGCTTGATGTGTACAGTAGTCAAGGCGTGGCCACACCAGCCATCACTGTCAGCAACTCCTGCCCAGCTGAGCTGCCCAACATCAAACGGGAGATCTCTGAGACCGAGGCAAAGGCCCTTTTGAAGGAACGGCAGAAGAAAGACAATCACAACCTAATTGAGCGTCGCAGGCGATTCAACATTAACGACAGGATCAAGGAACTGGGCACTCTCATCCCTAAGTCCAGTGACCCGGAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000068323

numer dostępu NCBI

NM_006521

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... TFE3(7030) , TFE3(7030)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Nunzia Pastore et al.
The EMBO journal, 38(12) (2019-05-28)
Autophagy and energy metabolism are known to follow a circadian pattern. However, it is unclear whether autophagy and the circadian clock are coordinated by common control mechanisms. Here, we show that the oscillation of autophagy genes is dependent on the
Na Zhang et al.
EBioMedicine, 40, 151-162 (2019-02-04)
Programmed death-ligand 1 (PD-L1) is a T-cell inhibitory checkpoint molecule that suppresses antitumor immunity. Anti-PD-L1 antibodies have shown remarkable promise in treating tumors, but the patient response rate is low. Therefore, small-molecule checkpoint inhibitors blocking PD-L1 function are urgently needed.
Leeanna El-Houjeiri et al.
Cell reports, 26(13), 3613-3628 (2019-03-28)
TFEB and TFE3 are transcriptional regulators of the innate immune response, but the mechanisms regulating their activation upon pathogen infection are poorly elucidated. Using C. elegans and mammalian models, we report that the master metabolic modulator 5'-AMP-activated protein kinase (AMPK) and
Chuanbin Yang et al.
Redox biology, 32, 101445-101445 (2020-02-11)
TFEB (transcription factor EB) and TFE3 (transcription factor E3) are "master regulators" of autophagy and lysosomal biogenesis. The stress response p38 mitogen-activated protein (MAP) kinases affect multiple intracellular responses including inflammation, cell growth, differentiation, cell death, senescence, tumorigenesis, and autophagy.
Ikue Tai-Nagara et al.
Nature communications, 11(1), 6314-6314 (2020-12-11)
Blood and lymphatic vessels structurally bear a strong resemblance but never share a lumen, thus maintaining their distinct functions. Although lymphatic vessels initially arise from embryonic veins, the molecular mechanism that maintains separation of these two systems has not been

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej