Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000168036

numer dostępu NCBI

NM_001098209

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... CTNNB1(1499) , CTNNB1(1499)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Nianchun Hu et al.
Biochemical and biophysical research communications, 533(4), 1457-1463 (2020-12-04)
Oxycodone is a common type of opioid used for the treatment of moderate to severe pain. Besides its analgesic effects on neuron cells, the effects of oxycodone on other cell types are yet to be elucidated. We previously demonstrated that
Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Miguel Ángel Sarabia-Sánchez et al.
Frontiers in oncology, 10, 1039-1039 (2020-08-09)
ALDH is an enzyme involved in different cellular processes, including cancer. It has been shown that a cellular subpopulation with high ALDH activity (ALDHHIGH) within a tumor is related to functional capabilities such as stemness, chemoresistance, and tumorigenicity. However, few
Izabela Janus et al.
Acta veterinaria Hungarica, 64(1), 90-102 (2016-02-27)
Primary heart tumours affect less than 1% of dogs. Due to their rare incidence, every research showing the frequency of cardiac tumours is valuable. Routine diagnostics is often complemented with immunohistochemical analysis. This study was conducted on 110 patient records
Xuejie Jiang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(10), 2417-2429 (2018-02-22)
Purpose: Wnt/β-catenin signaling is required for leukemic stem cell function. FLT3 mutations are frequently observed in acute myeloid leukemia (AML). Anomalous FLT3 signaling increases β-catenin nuclear localization and transcriptional activity. FLT3 tyrosine kinase inhibitors (TKI) are used clinically to treat
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej