Przejdź do zawartości
Merck

EHU108601

Sigma-Aldrich

MISSION® esiRNA

targeting human RBM4, RBM14-RBM4

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGAGATTCGCTCACTCTTCGAGCAGTATGGGAAGGTGCTGGAATGTGACATCATTAAGAATTACGGCTTTGTGCACATAGAAGACAAGACGGCAGCTGAGGATGCCATACGCAACCTGCACCATTACAAGCTTCATGGGGTGAACATCAACGTGGAAGCCAGCAAGAATAAGAGCAAAACCTCAACAAAGTTGCATGTGGGCAACATCAGTCCCACCTGCACCAATAAGGAGCTTCGAGCCAAGTTTGAGGAGTATGGTCCGGTCATCGAATGTGACATCGTGAAAGATTATGCCTTCGTACACATGGAGCGGGCAGAGGATGCAGTGGAGGCCATCAGGGGCCTTGATAACACAGAGTTTCAAGGCAAACGAATGCACGTGCAGTTGTCCACCAGCCGGCTTAGGACTGCGCCCGGGATGGGAGACCAGAGCGGCTGCTATCGGTGCGGGAAAGAGGGGCACTGGTCCAAAGAGTGTCCG

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Guo-Wei Huang et al.
The international journal of biochemistry & cell biology, 90, 59-67 (2017-07-30)
LncRNAs play a vital role in alternative splicing of target genes. However, the mechanisms underlying lncRNAs involvement in splicing are poorly understood. In the present study, we identified a previously uncharacterized lncRNA, which is denoted as TPM1-AS, is reverse-transcribed from
S Kagawa et al.
Oncogene, 34(18), 2347-2359 (2014-06-17)
Notch activity regulates tumor biology in a context-dependent and complex manner. Notch may act as an oncogene or a tumor-suppressor gene even within the same tumor type. Recently, Notch signaling has been implicated in cellular senescence. Yet, it remains unclear
Sven Hennig et al.
The Journal of cell biology, 210(4), 529-539 (2015-08-19)
Prion-like domains (PLDs) are low complexity sequences found in RNA binding proteins associated with the neurodegenerative disorder amyotrophic lateral sclerosis. Recently, PLDs have been implicated in mediating gene regulation via liquid-phase transitions that drive ribonucleoprotein granule assembly. In this paper

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej