Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU061621

Sigma-Aldrich

MISSION® esiRNA

targeting human PAX8

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AGCAAGATCCTTGGCAGGTACTACGAGACTGGCAGCATCCGGCCTGGAGTGATAGGGGGCTCCAAGCCCAAGGTGGCCACCCCCAAGGTGGTGGAGAAGATTGGGGACTACAAACGCCAGAACCCTACCATGTTTGCCTGGGAGATCCGAGACCGGCTCCTGGCTGAGGGCGTCTGTGACAATGACACTGTGCCCAGTGTCAGCTCCATTAATAGAATCATCCGGACCAAAGTGCAGCAACCATTCAACCTCCCTATGGACAGCTGCGTGGCCACCAAGTCCCTGAGTCCCGGACACACGCTGATCCCCAGCTCAGCTGTAACTCCCCCGGAGTCACCCCAGTCGGATTCCCTGGGCTCCACCTACTCCATCAATGGGCTCCTGGGCATCGCTCAGCCTGGCAGCGACAAGAGGAAAATGGATGACAGTGATCAGGATAGCTGCCGACTAAGCATTGACTCACAGAGCAGCAGCAG

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000125618

numer dostępu NCBI

NM_013992

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PAX8(7849) , PAX8(7849)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hui Tong et al.
Aging, 12(1), 70-79 (2020-01-10)
Long noncoding RNAs play vital roles in several biological processes, including cell growth and embryonic development. We showed that MACC1-AS1 was overexpressed in hepatocellular carcinoma (HCC) cells and tissues. The MACC1-AS1 expression level was dramatically upregulated in HCC samples compared
Laura R Hardy et al.
Oncogene, 38(32), 6003-6016 (2019-07-13)
High grade serous ovarian cancer (HGSOC) is the fifth leading cause of cancer deaths among women yet effective targeted therapies against this disease are limited. The heterogeneity of HGSOC, including few shared oncogenic drivers and origination from both the fallopian
Dima Ghannam-Shahbari et al.
Oncogene, 37(17), 2213-2224 (2018-01-31)
High grade serous carcinoma (HGSC) is the most common subtype of ovarian cancer and it is now widely accepted that this disease often originates from the fallopian tube epithelium. PAX8 is a fallopian tube lineage marker with an essential role
Amata Amy Soriano et al.
Cancer cell international, 19, 303-303 (2019-12-14)
Ovarian cancer is the third most common cause of death among gynecologic malignancies worldwide. Understanding the biology and molecular pathogenesis of ovarian epithelial tumors is key to developing improved prognostic indicators and effective therapies. We aimed to determine the effects

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej