Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU081461

Sigma-Aldrich

MISSION® esiRNA

targeting human AXL

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00


Check Cart for Availability


Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00


Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGATCAATTATAGTTTCTGAGGCTTTATGATAATAGATTCTCTTGTATAAGATCCTAGATCCTAAGGGTCGAAAGCTCTAGAATCTGCAATTCAAAAGTTCCAAGAGTCTAAAGATGGAGTTTCTAAGGTCCGGTGTTCTAAGATGTGATATTCTAAGACTTACTCTAAGATCTTAGATTCTCTGTGTCTAAGATTCTAGATCAGATGCTCCAAGATTCTAGATGATTAAATAAGATTCTAACGGTCTGTTCTGTTTCAAGGCACTCTAGATTCCATTGGTCCAAGATTCCGGATCCTAAGCATCTAAGTTATAAGACTCTCACACTCAGTTGTGACTAACTAGACACCAAAGTTCTAATAATTTCTAATGTTGGACACCTTTAGGTTCTTTGCTGCATTCTGC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AXL(558) , AXL(558)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Qiang Zuo et al.
Oncogene, 37(24), 3275-3289 (2018-03-20)
Multiple genetic mutations within melanoma not only cause lesion-specific responses to targeted therapy but also alter the molecular route of resistance to that therapy. Inactivation of PTEN occurs in up to 30% of melanomas, frequently with a concurrent activating BRAF
Jeanne M Quinn et al.
Molecular cancer therapeutics, 18(2), 389-398 (2018-11-28)
Ovarian cancer, one of the deadliest malignancies in female cancer patients, is characterized by recurrence and poor response to cytotoxic chemotherapies. Fewer than 30% of patients with resistant disease will respond to additional chemotherapy treatments. This study aims to determine
Alexandra Blake et al.
Scientific reports, 7, 46525-46525 (2017-04-20)
Triple-negative breast cancer (TNBC) lacks the expression of estrogen receptor α, progesterone receptor and human epidermal growth factor receptor 2 (HER2). TNBC patients lack targeted therapies, as they fail to respond to endocrine and anti-HER2 therapy. Prognosis for this aggressive
Kei Namba et al.
Molecular cancer research : MCR, 17(2), 499-507 (2018-11-23)
Osimertinib (AZD9291) has an efficacy superior to that of standard EGFR-tyrosine kinase inhibitors for the first-line treatment of patients with EGFR-mutant advanced non-small cell lung cancer (NSCLC). However, patients treated with osimertinib eventually acquire drug resistance, and novel therapeutic strategies
Laura M Divine et al.
Oncotarget, 7(47), 77291-77305 (2016-10-21)
The receptor tyrosine kinase AXL promotes migration, invasion, and metastasis. Here, we evaluated the role of AXL in endometrial cancer. High immunohistochemical expression of AXL was found in 76% (63/83) of advanced-stage, and 77% (82/107) of high-grade specimens and correlated

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica