Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU023531

Sigma-Aldrich

MISSION® esiRNA

targeting human RB1

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em13 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em13 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

TGCATGGCTCTCAGATTCACCTTTATTTGATCTTATTAAACAATCAAAGGACCGAGAAGGACCAACTGATCACCTTGAATCTGCTTGTCCTCTTAATCTTCCTCTCCAGAATAATCACACTGCAGCAGATATGTATCTTTCTCCTGTAAGATCTCCAAAGAAAAAAGGTTCAACTACGCGTGTAAATTCTACTGCAAATGCAGAGACACAAGCAACCTCAGCCTTCCAGACCCAGAAGCCATTGAAATCTACCTCTCTTTCACTGTTTTATAAAAAAGTGTATCGGCTAGCCTATCTCCGGCTAAATACACTTTGTGAACGCCTTCTGTCTGAGCACCCAGAATTAGAACATATCATCTGGACCCTTTTCCAGCACACCCTGCAGAATGAGTATGAACTCATGAGAGACAGGCATTTGGACC

Ensembl | Número de adesão de ser humano

ENSG00000139687

nº de adesão NCBI

NM_000321

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... RB1(5925) , RB1(5925)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
LUU
BDU
XUT
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Toshiyuki Sumi et al.
Biochemical and biophysical research communications, 501(1), 253-258 (2018-05-05)
High expression levels of survivin in KRAS-mutant lung adenocarcinomas are linked with unfavorable patient outcomes, suggesting that survivin is a promising target for tumor treatment. We found that trametinib, a MEK inhibitor, downregulates survivin expression in the RB1-positive KRAS-mutant lung
Chun-Yu Liu et al.
PloS one, 12(12), e0189007-e0189007 (2017-12-21)
Triple negative breast cancer (TNBC) lacks specific drug targets and remains challenging. Palbociclib, a cyclin-dependent kinases 4 and 6 (CDK4/6) inhibitor is approved for metastatic estrogen receptor (ER)-positive and human epithermal growth factor 2 (HER2)-negative breast cancer. The nature of
Elisabetta Marangoni et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(11), 2605-2615 (2018-02-22)
Purpose: Triple-negative breast cancer (TNBC) patients with residual disease after neoadjuvant chemotherapy have a poor outcome. We developed patient-derived xenografts (PDX) from residual tumors to identify efficient chemotherapies and predictive biomarkers in a context of resistance to anthracyclines- and taxanes-based
Karen McColl et al.
Oncotarget, 8(43), 73745-73756 (2017-11-02)
The majority of small cell lung cancer (SCLC) patients demonstrate initial chemo-sensitivity, whereas a distinct subgroup of SCLC patients, termed chemo-refractory, do not respond to treatment. There is little understanding of how to distinguish these patients prior to disease treatment.
Gabrielle van Caloen et al.
Molecular cancer therapeutics, 19(3), 777-789 (2020-01-12)
Cell-cycle pathway impairments resulting in CDK4 and 6 activation are frequently observed in human papillomavirus (HPV)-negative squamous cell carcinoma of the head and neck (SCCHN). We investigated the activity of ribociclib, a CDK4/6 inhibitor, in SCCHN models with the aim
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica