Pular para o conteúdo
Merck
Todas as fotos(1)

Key Documents

EHU007471

Sigma-Aldrich

MISSION® esiRNA

targeting human ST6GALNAC5

Faça loginpara ver os preços organizacionais e de contrato


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

Nível de qualidade

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

TTACTCGCCACAAGATGCTGCAGTTTGATGAGCTCTTCAAGCAGGAGACTGGCAAAGACAGGAAGATATCCAACACTTGGCTCAGCACTGGCTGGTTTACAATGACAATTGCACTGGAGCTCTGTGACAGGATCAATGTTTATGGCATGGTGCCCCCAGACTTCTGCAGGGATCCCAATCACCCTTCAGTACCTTATCATTATTATGAACCTTTTGGACCTGATGAATGTACAATGTACCTCTCCCATGAGCGAGGACGCAAGGGCAGTCATCACCGCTTTATCACAGAGAAACGAGTCTTTAAGAACTGGGCACGGACATTCAATATTCACTTTTTTCAACCAGACTGGAAACCAGAATCACTTGCTATAAATCATCCTGAGAATAAACCTGTGTTCTAAGGAATGAGCATGCCAGACTGTAATCCCAGGTATTCACTGCATCAGACACCGAGACACTGAACTTCCTGAGCCACCAGACAGGAAAGGGTAGCAGAAAACAGCTTCACTCCTCAGGAAGTACCATGGACAGACGCC

Ensembl | Número de adesão de ser humano

nº de adesão NCBI

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Ações bioquímicas/fisiológicas

ST6GALNAC5 (α-N-acetylgalactosaminide α-2,6-sialyltransferase 5) participates in the biosynthesis of α-series gangliosides. It is linked with breast cancer metastasis to the brain. ST6GALNAC5 reduces the association between breast cancer cells and human blood brain barrier. Mutations in this gene are associated with coronary artery disease.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable


Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

ST6GALNAC5 Expression Decreases the Interactions between Breast Cancer Cells and the Human Blood-Brain Barrier.
Drolez A et al.
International Journal of Molecular Sciences, 17, E1309-E1309 (2016)
Kolsoum InanlooRahatloo et al.
Scientific reports, 4, 3595-3595 (2014-01-09)
We aimed to identify the genetic cause of coronary artery disease (CAD) in an Iranian pedigree. Genetic linkage analysis identified three loci with an LOD score of 2.2. Twelve sequence variations identified by exome sequencing were tested for segregation with

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica