Direkt zum Inhalt
Merck

EHU110531

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIB

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ATGTAGGCCGGGTGATCTTTGGTCTCTTCGGAAAGACTGTTCCAAAAACAGTGGATAATTTTGTGGCCTTAGCTACAGGAGAGAAAGGATTTGGCTACAAAAACAGCAAATTCCATCGTGTAATCAAGGACTTCATGATCCAGGGCGGAGACTTCACCAGGGGAGATGGCACAGGAGGAAAGAGCATCTACGGTGAGCGCTTCCCCGATGAGAACTTCAAACTGAAGCACTACGGGCCTGGCTGGGTGAGCATGGCCAACGCAGGCAAAGACACCAACGGCTCCCAGTTCTTCATCACGACAGTCAAGACAGCCTGGCTAGATGGCAAGCATGTGGTGTTTGGCAAAGTTCTAGAGGGCATGGAGGTGGTGCGGAAGGTGGAGAGCACCAAGACAGACAGCCGGGATAAACCCCTGAAGGATGTGATCATCGCAGACTGCGGCAAGATCGAGGTGGAGAAG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Li Liu et al.
Retrovirology, 8, 94-94 (2011-11-16)
Upon cellular entry retroviruses must avoid innate restriction factors produced by the host cell. For human immunodeficiency virus (HIV) human restriction factors, APOBEC3 (apolipoprotein-B-mRNA-editing-enzyme), p21 and tetherin are well characterised. To identify intrinsic resistance factors to HIV-1 replication we screened
Paulo C M Urbano et al.
Frontiers in immunology, 10, 3047-3047 (2020-02-11)
Maintenance of regulatory T cells CD4+CD25highFOXP3+ (Treg) stability is vital for proper Treg function and controlling the immune equilibrium. Treg cells are heterogeneous and can reveal plasticity, exemplified by their potential to express IL-17A. TNFα-TNFR2 signaling controls IL-17A expression in
Roberto A Avelar et al.
Genome biology, 21(1), 91-91 (2020-04-09)
Cellular senescence, a permanent state of replicative arrest in otherwise proliferating cells, is a hallmark of aging and has been linked to aging-related diseases. Many genes play a role in cellular senescence, yet a comprehensive understanding of its pathways is
J E Hanning et al.
British journal of cancer, 108(2), 450-460 (2013-01-10)
When designing therapeutic short-interfering RNAs (siRNAs), off-target effects (OTEs) are usually predicted by computational quantification of messenger RNAs (mRNAs) that contain matches to the siRNA seed sequence in their 3' UTRs. It is assumed that the higher the number of
Ana O'Loghlen et al.
Cell stem cell, 10(1), 33-46 (2012-01-10)
The Polycomb Group (PcG) of chromatin modifiers regulates pluripotency and differentiation. Mammalian genomes encode multiple homologs of the Polycomb repressive complex 1 (PRC1) components, including five orthologs of the Drosophila Polycomb protein (Cbx2, Cbx4, Cbx6, Cbx7, and Cbx8). We have

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.