Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU151981

Sigma-Aldrich

MISSION® esiRNA

targeting human HIF1A

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGCAACATGGAAGGTATTGCACTGCACAGGCCACATTCACGTATATGATACCAACAGTAACCAACCTCAGTGTGGGTATAAGAAACCACCTATGACCTGCTTGGTGCTGATTTGTGAACCCATTCCTCACCCATCAAATATTGAAATTCCTTTAGATAGCAAGACTTTCCTCAGTCGACACAGCCTGGATATGAAATTTTCTTATTGTGATGAAAGAATTACCGAATTGATGGGATATGAGCCAGAAGAACTTTTAGGCCGCTCAATTTATGAATATTATCATGCTTTGGACTCTGATCATCTGACCAAAACTCATCATGATATGTTTACTAAAGGACAAGTCACCACAGGACAGTACAGGATGCTTGCCAAAAGAGGTGGATATGTCTGGGTTGAAACTCAAGC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000100644

numer dostępu NCBI

NM_001530

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... HIF1A(3091) , HIF1A(3091)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Nie możesz znaleźć właściwego produktu?  

Wypróbuj nasz Narzędzie selektora produktów.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
WAV
PZU
PXU
VUU
BTU

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Klaartje Somers et al.
Oncogene, 38(20), 3824-3842 (2019-01-24)
Survival rates for pediatric patients suffering from mixed lineage leukemia (MLL)-rearranged leukemia remain below 50% and more targeted, less toxic therapies are urgently needed. A screening method optimized to discover cytotoxic compounds selective for MLL-rearranged leukemia identified CCI-006 as a
Shu Lou et al.
Frontiers in cell and developmental biology, 8, 576-576 (2020-08-09)
Although genetic variants in autophagy pathway genes were associated with the risk of oral cancers and early development in embryos, their associations with non-syndromic cleft lip with or without cleft palate (NSCL/P) risk remained unclear. A two-stage case-control study (2,027
Qianqian Gao et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 74, 57-62 (2015-09-10)
A major cause of morbidity and mortality in cardiovascular disease is pathological cardiac hypertrophy. With an increase in the cellular surface area and upregulation of the atrial natriuretic peptide (ANP) gene, cardiac hypertrophy is a prominent feature of diabetic cardiomyopathy.
Matilda Munksgaard Thorén et al.
Oncotarget, 8(30), 48983-48995 (2017-04-22)
We previously demonstrated that small cell lung carcinoma (SCLC) cells lack HIF-2α protein expression, whereas HIF-1α in these cells is expressed at both acute and prolonged hypoxia. Here we show that low HIF2A expression correlates with high expression of MYC
Damir Kračun et al.
Redox biology, 34, 101536-101536 (2020-05-16)
Cardiovascular side effects are frequent problems accompanying systemic glucocorticoid therapy, although the underlying mechanisms are not fully resolved. Reactive oxygen species (ROS) have been shown to promote various cardiovascular diseases although the link between glucocorticoid and ROS signaling has been
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej