Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU113241

Sigma-Aldrich

MISSION® esiRNA

targeting human G3BP1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGCCTCAGGAGGAGTCTGAAGAAGAAGTAGAGGAACCTGAAGAAAGACAGCAAACACCTGAGGTGGTACCTGATGATTCTGGAACTTTCTATGATCAGGCAGTTGTCAGTAATGACATGGAAGAACATTTAGAGGAGCCTGTTGCTGAACCAGAGCCTGATCCTGAACCAGAACCAGAACAAGAACCTGTATCTGAAATCCAAGAGGAAAAGCCTGAGCCAGTATTAGAAGAAACTGCCCCTGAGGATGCTCAGAAGAGTTCTTCTCCAGCACCTGCAGACATAGCTCAGACAGTACAGGAAGACTTGAGGACATTTTCTTGGGCATCTGTGACCAGTAAGAATCTTCCACCCAGTGGAGCTGTTCCAGTTACTGGGATACCACCTCATGTTGTTAAAGTACCAGCTTCACAGCCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000145907

numer dostępu NCBI

NM_005754

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... G3BP1(10146) , G3BP1(10146)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Ning Dou et al.
American journal of cancer research, 6(11), 2641-2650 (2016-12-03)
RasGAP SH3-domain-Binding Protein 1 (G3BP1) has been implicated in cell growth, migration, and metastasis of some cancers, yet its function in hepatocellular carcinoma (HCC) remains to be explored. In the present study, we reported that G3BP1 was upregulated in HCC
Amr Omer et al.
EMBO reports, 19(5) (2018-03-30)
Cellular senescence is a physiological response by which an organism halts the proliferation of potentially harmful and damaged cells. However, the accumulation of senescent cells over time can become deleterious leading to diseases and physiological decline. Our data reveal a
Amr Omer et al.
Nature communications, 11(1), 4979-4979 (2020-10-07)
Cellular senescence is a known driver of carcinogenesis and age-related diseases, yet senescence is required for various physiological processes. However, the mechanisms and factors that control the negative effects of senescence while retaining its benefits are still elusive. Here, we
Allison B Herman et al.
Arteriosclerosis, thrombosis, and vascular biology, 39(10), 2014-2027 (2019-08-30)
Stress granules (SGs) are dynamic cytoplasmic aggregates containing mRNA, RNA-binding proteins, and translation factors that form in response to cellular stress. SGs have been shown to contribute to the pathogenesis of several human diseases, but their role in vascular diseases
David Pla-Martín et al.
The EMBO journal, 39(9), e102731-e102731 (2020-03-10)
Mitochondria house anabolic and catabolic processes that must be balanced and adjusted to meet cellular demands. The RNA-binding protein CLUH (clustered mitochondria homolog) binds mRNAs of nuclear-encoded mitochondrial proteins and is highly expressed in the liver, where it regulates metabolic

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej