Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU072991

Sigma-Aldrich

MISSION® esiRNA

targeting human HMGB1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

CACACCCTGCATATCATAATGGGGGTAAAGTTAAGTTGAGATAGTTTTCATCCATAACTGAACATCCAAAATCTTGATCAGTTAAGAAATTTCACATAGCCCACTTACATTTACAAACTGAAGAGTAATCAATCTACTCAAAGCATGGGATTATTAGAATCAAACATTTTGAAAGTCTGTCCTTGAAGGACTAATAGAAAAGTATGTTCTAACCTTTACATGAGGACTCTATTCTTTAACTCCCATTACCATGTAATGGCAGTTATATTTTGCAGTTCCCACATTAAAGAAGACCTGAGAATGTATCCCCAAAAGCGTGAGCTTAAAATACAAGACTGCCATATTAAATTTTTTGTTGACATTAGTCTCAGTGAAGACTATGAAAATGCTGGCTATAGATGTCTTTTCC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000189403

numer dostępu NCBI

NM_002128

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... HMGB1(3146) , HMGB1(3146)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yuan Zhang et al.
Journal of neuroinflammation, 12, 156-156 (2015-09-05)
Mounting evidence has indicated that high-mobility group box 1 (HMGB1) is involved in cell activation and migration. Our previous study demonstrated that methamphetamine mediates activation of astrocytes via sigma-1 receptor (σ-1R). However, the elements downstream of σ-1R in this process
Yan Chen et al.
International journal of clinical and experimental pathology, 8(6), 6683-6691 (2015-08-12)
Diabetic nephropathy (DN) is one of the most devastating complications of diabetes, leading the cause of end-stage renal disease (ESRD). And investigations into mechanisms underlying renal inflammation may provide new insight into novel therapeutic targets for patients with DN. However
Minghua Yang et al.
Autophagy, 11(2), 214-224 (2015-01-22)
Both apoptosis ("self-killing") and autophagy ("self-eating") are evolutionarily conserved processes, and their crosstalk influences anticancer drug sensitivity and cell death. However, the underlying mechanism remains unclear. Here, we demonstrated that HMGB1 (high mobility group box 1), normally a nuclear protein
Zhe Liu et al.
Chinese journal of cancer research = Chung-kuo yen cheng yen chiu, 27(3), 267-278 (2015-07-15)
The purpose of this study was to examine the effect of gemcitabine (GEM) on microRNA-218 (miR-218) expression in human pancreatic cancer cells. Quantitative reverse transcription polymerase chain reaction (qRT-PCR) was performed to examine the differences in miR-218 expression between the

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej