Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU063661

Sigma-Aldrich

MISSION® esiRNA

targeting human METTL3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

GAGCCAGCCAAGAAATCAAGGAAACATGCTGCCTCAGATGTTGATCTGGAGATAGAGAGCCTTCTGAACCAACAGTCCACTAAGGAACAACAGAGCAAGAAGGTCAGTCAGGAGATCCTAGAGCTATTAAATACTACAACAGCCAAGGAACAATCCATTGTTGAAAAATTTCGCTCTCGAGGTCGGGCCCAAGTGCAAGAATTCTGTGACTATGGAACCAAGGAGGAGTGCATGAAAGCCAGTGATGCTGATCGACCCTGTCGCAAGCTGCACTTCAGACGAATTATCAATAAACACACTGATGAGTCTTTAGGTGACTGCTCTTTCCTTAATACATGTTTCCACATGGATACCTGCAAGTATGTTCACTATGAAATTGATGCTTGCATGGATTCTGAGGCCCCTGGCAGCAAAGACCACACGCCAAGCCAGGAGCTTGCTCTTACACAGAGTGTCGGAGGTGATTCCAGT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000165819

numer dostępu NCBI

NM_019852

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... METTL3(56339) , METTL3(56339)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

12 - Non Combustible Liquids

Klasa zagrożenia wodnego (WGK)

WGK 1

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Hongbing Wu et al.
Genes and immunity, 21(3), 193-202 (2020-05-28)
Maturation of dendritic cells (DCs) initiates adaptive immune responses and thereby provokes allograft rejection. Here, this study aimed to explore the effect of Methyltransferase-like protein 3 (METTL3) silencing on DC function and the role of METTL3-silencing donor DCs in the
Shiyan Gu et al.
Toxicology letters, 292, 1-11 (2018-04-24)
N6-methyladenosine (m6A) modification is implicated to play an important role in cellular biological processes, but its regulatory mechanisms in arsenite-induced carcinogenesis are largely unknown. Here, human bronchial epithelial (HBE) cells were chronically treated with 2.5 μM arsenite sodium (NaAsO2) for about
Ye Lin et al.
Cancer medicine, 9(8), 2859-2867 (2020-02-19)
METTL3 is an RNA methyltransferase implicated in the control of cell differentiation and proliferation in embryonic development and cancer. The current study was aimed to explore the function and underlying mechanism of METTL3 in hepatocellular carcinoma (HCC). We evaluated the
Daniel A Lorenz et al.
RNA (New York, N.Y.), 26(1), 19-28 (2019-10-19)
Direct RNA sequencing holds great promise for the de novo identification of RNA modifications at single-coordinate resolution; however, interpretation of raw sequencing output to discover modified bases remains a challenge. Using Oxford Nanopore's direct RNA sequencing technology, we developed a
Ly P Vu et al.
Nature medicine, 23(11), 1369-1376 (2017-09-19)
N6-methyladenosine (m6A) is an abundant nucleotide modification in mRNA that is required for the differentiation of mouse embryonic stem cells. However, it remains unknown whether the m6A modification controls the differentiation of normal and/or malignant myeloid hematopoietic cells. Here we
Wyświetl wszystkie powiązane dokumenty

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej