Przejdź do zawartości
Merck
Wszystkie zdjęcia(2)

Kluczowe dokumenty

EHU051011

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wybierz wielkość

20 μG
1060,00 zł
50 μG
1910,00 zł

1060,00 zł


Skontaktuj się z Obsługą Klienta, aby uzyskać informacje na temat dostępności


Wybierz wielkość

Zmień widok
20 μG
1060,00 zł
50 μG
1910,00 zł

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

1060,00 zł


Skontaktuj się z Obsługą Klienta, aby uzyskać informacje na temat dostępności

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

CTGCACCGAAACCGAGTTATTCATCGAGACCTCAAGCTGGGCAACCTTTTCCTGAATGAAGATCTGGAGGTGAAAATAGGGGATTTTGGACTGGCAACCAAAGTCGAATATGACGGGGAGAGGAAGAAGACCCTGTGTGGGACTCCTAATTACATAGCTCCCGAGGTGCTGAGCAAGAAAGGGCACAGTTTCGAGGTGGATGTGTGGTCCATTGGGTGTATCATGTATACCTTGTTAGTGGGCAAACCACCTTTTGAGACTTCTTGCCTAAAAGAGACCTACCTCCGGATCAAGAAGAATGAATACAGTATTCCCAAGCACATCAACCCCGTGGCCGCCTCCCTCATCCAGAAGATGCTTCAGACAGATCCCACTGCCCGCCCAACCATTAACGAGCTGCT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Jinhua Dong et al.
Biotechnology and bioengineering, 117(5), 1259-1269 (2020-02-11)
Ultra Quenchbody (UQ-body) is a biosensor that utilizes the quenching behavior of the fluorescent dye linked to the antibody V region. When the corresponding antigen is bound to the UQ-body, the fluorescence is restored and allows the detection of target
Owen Addis Jones et al.
Nature communications, 10(1), 2861-2861 (2019-06-30)
Centromeres provide a pivotal function for faithful chromosome segregation. They serve as a foundation for the assembly of the kinetochore complex and spindle connection, which is essential for chromosome biorientation. Cells lacking Polo-like kinase 1 (PLK1) activity suffer severe chromosome alignment
James C Evans et al.
Molecular pharmaceutics, 14(1), 42-52 (2017-01-04)
In recent years, RNA interference (RNAi) has emerged as a potential therapeutic offering the opportunity to treat a wide range of diseases, including prostate cancer. Modified cyclodextrins have emerged as effective gene delivery vectors in a range of disease models.
Yih-Gang Goan et al.
Cancers, 11(8) (2019-08-08)
Oral squamous cell carcinoma (OSCC) is one of the major leading causes of cancer-related death worldwide, with limited effective markers for diagnosis and therapy, which has caused a low overall survival rate in the past decades. Kinases play important roles
Hui Shi et al.
International journal of nanomedicine, 15, 3347-3362 (2020-06-05)
Temozolomide (TMZ) is the first-line chemotherapeutic option to treat glioma; however, its efficacy and clinical application are limited by its drug resistance properties. Polo-like kinase 1 (PLK1)-targeted therapy causes G2/M arrest and increases the sensitivity of glioma to TMZ. Therefore

Produkty

Quantitative and qualitative western blotting to validate knockdown by esiRNA.

Questions

Reviews

No rating value

Active Filters

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej