Passa al contenuto
Merck
Tutte le immagini(1)

Key Documents

HLTUD002C

Sigma-Aldrich

MISSION® Lenti microRNA Inhibitor

cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences

Sinonimo/i:

Tough Decoy, TuD

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41106609
NACRES:
NA.51

Nome Commerciale

MISSION®

Forma fisica

liquid

Concentrazione

≥1x106 VP/ml (via p24 assay)

Sequenza matura

CGGUACGAUCGCGGCGGGAUAUC

N° accesso Sanger maturo/minor

MIMAT0000299

N° accesso Sanger microRNA

MI0000319

Condizioni di spedizione

dry ice

Temperatura di conservazione

−70°C

Cerchi prodotti simili? Visita Guida al confronto tra prodotti

Descrizione generale

Individual lenti microRNA inhibitors are designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo. This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. The lentiviral microRNA Inhibitors are cloned into the TRC2-pLKO-puro vector. Co-transfection of this vector into the appropriate cell line with compatible packaging plasmids produces viral particles that can be used to transduce mammalian cells. Additionally, the Woodchuck Hepatitis Post-Transcriptional Regulatory Element2 (WPRE) is included, allowing for enhanced expression of transgenes delivered by lentiviral vectors. This lentiviral vector also carries a puromycin resistance gene for selection of cells.

  • Allows for potent inhibition of the desired miRNA
  • Lentiviral delivery format allows for efficient delivery of the inhibitor into a wide variety of cell types
  • Enables long-term inhibition without repeat transfection

Altre note

Based on miRBase V19 Mature ID

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

12 - Non Combustible Liquids

Classe di pericolosità dell'acqua (WGK)

WGK 3

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Ruben Aquino-Martinez et al.
Journal of bone and mineral research : the official journal of the American Society for Bone and Mineral Research, 34(1), 135-144 (2018-10-16)
Developing novel approaches to treat skeletal disorders requires an understanding of how critical molecular factors regulate osteoblast differentiation and bone remodeling. We have reported that (1) retinoic acid receptor-related orphan receptor beta (Rorβ) is upregulated in bone samples isolated from
Yang Wang et al.
Journal of cellular biochemistry (2019-03-02)
Spinal cord injury (SCI) has been a major burden on the society because of the high rate of disability. Receptor-interacting protein 3 (RIP3)-mediated necroptosis is a newly discovered pathway of programmed cell death and is involved in multiple pathologies of

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.