NCSTUD002
MISSION® Synthetic microRNA Inhibitor
cel-miR-243-3p, Negative Control 2, Sequence from Caenorhabditis elegans with no homology to human and mouse gene sequences
Szinonimák:
Synthetic Tough Decoy, sTuD
Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez
Összes fotó(1)
About This Item
UNSPSC kód:
41105324
NACRES:
NA.51
Javasolt termékek
termékcsalád
MISSION®
form
solid
érett szekvencia
CGGUACGAUCGCGGCGGGAUAUC
Sanger érett/kisebb elérési szám
Sanger mikroRNS elérési szám
tárolási hőmérséklet
−20°C
Looking for similar products? Látogasson el ide Útmutató a termékösszehasonlításhoz
Általános leírás
Individual synthetic microRNA inhibitors were designed using a proprietary algorithm, which is based on the work of Haraguchi, T, et al. and in collaboration with Dr. Hideo Iba, University of Tokyo.† This algorithm utilizes the tough decoy (TuD) design. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
The MISSION synthetic miRNA Inhibitors are small, double-stranded RNA molecules designed to inhibit a specific mature miRNA. The miRNA inhibitors were designed using the mature miRNA sequence information from miRBase and are 2′-O-methylated RNA duplexes with a miRNA binding site on each strand. Optimal miRNA inhibition is provided after transfection due to the robust secondary structure of the inhibitor.
- Long lasting inhibition at very low dosage
- Excellent resistance to cellular nucleases
- Custom synthesis available for a variety of species
Egyéb megjegyzések
Based on miRBase V19
Jogi információk
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Figyelmeztetés
Warning
Figyelmeztető mondatok
Óvintézkedésre vonatkozó mondatok
Veszélyességi osztályok
STOT RE 2 Inhalation
Célzott szervek
Respiratory Tract
Tárolási osztály kódja
11 - Combustible Solids
WGK
WGK 3
Lobbanási pont (F)
Not applicable
Lobbanási pont (C)
Not applicable
Analitikai tanúsítványok (COA)
Analitikai tanúsítványok (COA) keresése a termék sarzs-/tételszámának megadásával. A sarzs- és tételszámok a termék címkéjén találhatók, a „Lot” vagy „Batch” szavak után.
Már rendelkezik ezzel a termékkel?
Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.
Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.
Lépjen kapcsolatba a szaktanácsadással