Ugrás a tartalomra
Merck
Összes fotó(1)

Fontos dokumentumok

EHU087041

Sigma-Aldrich

MISSION® esiRNA

targeting human BCL2L1

Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez


About This Item

UNSPSC kód:
41105324
NACRES:
NA.51

leírás

Powered by Eupheria Biotech

Minőségi szint

termékcsalád

MISSION®

Forma

lyophilized powder

esiRNS cDNS célszekvencia

TGTTTGTGGCCTCAGAATTGATCATTTTCCCCCCACTCTCCCCACACTAACCTGGGTTCCCTTTCCTTCCATCCCTACCCCCTAAGAGCCATTTAGGGGCCACTTTTGACTAGGGATTCAGGCTGCTTGGGATAAAGATGCAAGGACCAGGACTCCCTCCTCACCTCTGGACTGGCTAGAGTCCTCACTCCCAGTCCAAATGTCCTCCAGAAGCCTCTGGCTAGAGGCCAGCCCCACCCAGGAGGGAGGGGGCTATAGCTACAGGAAGCACCCCATGCCAAAGCTAGGGTGGCCCTTGCAGTTCAGCACCACCCTAGTCCCTTCCCCTCCCTGGCTCCCATGACCATACTGAGGGACCAACTGGGCCCAAGACAGATGCCCCAGAGCTGTTTATGGCCTCAGCTGCCTCACTTCCTACAAGAGCAGCCTGTG

Ensembl | humán elérési szám

NCBI elérési szám

kiszállítva

ambient

tárolási hőmérséklet

−20°C

Géninformáció

Általános leírás

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Jogi információk

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Nem találja a megfelelő terméket?  

Próbálja ki a Termékválasztó eszköz. eszközt

Tárolási osztály kódja

10 - Combustible liquids

Lobbanási pont (F)

Not applicable

Lobbanási pont (C)

Not applicable


Válasszon a legfrissebb verziók közül:

Analitikai tanúsítványok (COA)

Lot/Batch Number

Nem találja a megfelelő verziót?

Ha egy adott verzióra van szüksége, a tétel- vagy cikkszám alapján rákereshet egy adott tanúsítványra.

Már rendelkezik ezzel a termékkel?

Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.

Dokumentumtár megtekintése

Sahar Taghavi et al.
International journal of pharmaceutics, 516(1-2), 301-312 (2016-11-15)
In this project, synergistic cancer cell death was achieved by a targeted delivery system comprising Bcl-xL-specific shRNA and a very low DOX content, which simultaneously activated an intrinsic apoptotic pathway. A modified branched polyethylenimine (PEI 10kDa) was grafted through polyethylene
Yun Jung Choi et al.
Scientific reports, 9(1), 7193-7193 (2019-05-12)
Mantle cell lymphoma (MCL) is typically an aggressive and rare form of non-Hodgkin lymphoma (NHL) with a poor prognosis despite recent advances in immunochemotherapy and targeted therapeutics against NHL. New therapeutic agents are needed for MCL. In this study, we
Sachie Hirai et al.
Biochemical and biophysical research communications, 526(2), 417-423 (2020-04-01)
Although most EGFR-mutant lung adenocarcinomas initially respond to EGFR inhibitors, disease progression almost inevitably occurs. We previously reported that two EGFR-mutant lung adenocarcinoma cell lines, HCC827 and H1975, contain subpopulations of cells that display an epithelial-to-mesenchymal phenotype and can thrive
Wenshu Chen et al.
Molecular carcinogenesis, 55(11), 1858-1866 (2015-11-27)
The interaction between epithelial and stromal cells through soluble factors such as cytokines plays an important role in carcinogenesis. Breaking this cancer-promoting interaction poses an opportunity for cancer prevention. The tumor-promoting function of interleukin 6 (IL-6) has been documented; however
Jihong Shi et al.
Laboratory investigation; a journal of technical methods and pathology, 98(11), 1423-1437 (2018-08-10)
Hypertrophic scarring is a serious fibrotic skin disease, and the abnormal activation of hypertrophic scar fibroblasts (HSFs) intensifies its pathogenesis. Our previous studies have demonstrated that the dysregulation of autophagy in HSFs is associated with fibrosis. However, knowledge regarding the

Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.

Lépjen kapcsolatba a szaktanácsadással