Direkt zum Inhalt
Merck
Alle Fotos(1)

Dokumente

EHU070071

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF12A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

TTTCTGGCTTTTTGGTCTGGAGACGATGCCGCAGGAGAGAGAAGTTCACCACCCCCATAGAGGAGACCGGCGGAGAGGGCTGCCCAGCTGTGGCGCTGATCCAGTGACAATGTGCCCCCTGCCAGCCGGGGCTCGCCCACTCATCATTCATTCATCCATTCTAGAGCCAGTCTCTGCCTCCCAGACGCGGCGGGAGCCAAGCTCCTCCAACCACAAGGGGGGTGGGGGGCGGTGAATCACCTCTGAGGCCTGGGCCCAGGGTTCAGGGGAACCTTCCAAGGTGTCTGGTTGCCCTGCCTCTGGCTCCAGAACAGAAAGGGAGCCTCACGCTGGCTCACACAAAACAGCTGACACTGACTAAGGAACTGCAGCATTTGCACAGGGGAGGGGGGTGCCCTCCTTCCTAGAGGCCCTGGGGGCCAGGCTGACTTGGGGGGCAGACTTGACACTAGGCCC

Ensembl | Human Hinterlegungsnummer

ENSG00000006327

NCBI-Hinterlegungsnummer

NM_016639

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TNFRSF12A(51330) , TNFRSF12A(51330)

Verwandte Kategorien

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xuefeng Qi et al.
Frontiers in cellular and infection microbiology, 7, 315-315 (2017-07-27)
TLR4 in intestinal epithelial cells has been shown both inflammatory and homeostatic roles following binding of its cognate ligand lipopolysaccharide (LPS). TWEAK-Fn14 axis plays an important role in pathologies caused by excessive or abnormal inflammatory responses. This study aimed to
Li Hao et al.
Journal of cellular and molecular medicine, 22(9), 4344-4353 (2018-07-05)
Atrial myocyte hypertrophy is one of the most important substrates in the development of atrial fibrillation (AF). The TWEAK/Fn14 axis is a positive regulator of cardiac hypertrophy in cardiomyopathy. This study therefore investigated the effects of Fn14 on atrial hypertrophy
Zhengwei Li et al.
American journal of translational research, 8(12), 5386-5398 (2017-01-13)
Angiotesin II (Ang II) plays an important role in cardiac remodeling. Fibroblast growth factor inducible-14 (Fn14) is the smallest member of the tumor necrosis factor superfamily of receptors. Currently, little is known about the functional role of Fn14 in the
Alison Roos et al.
Molecular cancer research : MCR, 16(7), 1185-1195 (2018-05-05)
Glioblastoma multiforme (GBM) is the most common brain malignancies in adults. Most GBM patients succumb to the disease less than 1 year after diagnosis due to the highly invasive nature of the tumor, which prevents complete surgical resection and gives
Xuefeng Qi et al.
The Journal of general virology, 99(1), 36-43 (2017-12-09)
The pathogenesis of H9N2 subtype avian influenza virus (AIV) infection in hens is often related to oviduct tissue damage. Our previous study suggested that H9N2 AIV induces cellular apoptosis by activating reactive oxygen species (ROS) accumulation and mitochondria-mediated apoptotic signalling
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.