Direkt zum Inhalt
Merck

EHU001001

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF1A

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

ACCAAGTGCCACAAAGGAACCTACTTGTACAATGACTGTCCAGGCCCGGGGCAGGATACGGACTGCAGGGAGTGTGAGAGCGGCTCCTTCACCGCTTCAGAAAACCACCTCAGACACTGCCTCAGCTGCTCCAAATGCCGAAAGGAAATGGGTCAGGTGGAGATCTCTTCTTGCACAGTGGACCGGGACACCGTGTGTGGCTGCAGGAAGAACCAGTACCGGCATTATTGGAGTGAAAACCTTTTCCAGTGCTTCAATTGCAGCCTCTGCCTCAATGGGACCGTGCACCTCTCCTGCCAGGAGAAACAGAACACCGTGTGCACCTGCCATGCAGGTTTCTTTCTAAGAGAAAACGAGTGTGTCTCCTGTAGTAACTGTAAGAAAAGCCTGGAGTGCACGAAGTTGTGCCTACCCCAGATTGAGAATGTTAAGGGCACTGAGGACTCAGGCACCACAGTGCTGTTGCCCCTGGTCATTTTCTTTGGTCTTTGCCTTTTATCCCTCCTCTTCATTGGTTTAATGTATCGCTACCAACGGTGGAAGTCCAAGCTCTACTCCATTGTTTGTGGGAAATCGACA

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION® esiRNA ist durch Endoribonuklease hergestellte siRNA. Dabei handelt es sich um eine heterogene Mischung von siRNA, die alle dieselbe mRNA-Zielsequenz haben. Diese mehrfachen Auslöser bewirken eine hochspezifische und wirksame Genstummschaltung.

Weitere Einzelheiten sowie eine Darstellung aller erhältlichen esiRNA-Produkte finden Sie unter SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Yang Yu et al.
American journal of physiology. Heart and circulatory physiology, 313(4), H744-H756 (2017-07-16)
In systolic heart failure (HF), circulating proinflammatory cytokines upregulate inflammation and renin-angiotensin system (RAS) activity in cardiovascular regions of the brain, contributing to sympathetic excitation and cardiac dysfunction. Important among these is the subfornical organ (SFO), a forebrain circumventricular organ
Hui Xu et al.
Toxicology letters, 280, 171-180 (2017-09-03)
Dysregulation of microRNAs (miRNAs) has been implicated in the pathogenesis of chronic obstructive pulmonary disease (COPD), which is largely attributable to cigarette smoke (CS). However, little is known about the effect of miRNAs on CS-induced mucus hypersecretion and the inflammatory
Xusheng Wang et al.
Nature communications, 8, 14091-14091 (2017-03-28)
Skin stem cells can regenerate epidermal appendages; however, hair follicles (HF) lost as a result of injury are barely regenerated. Here we show that macrophages in wounds activate HF stem cells, leading to telogen-anagen transition (TAT) around the wound and
Susana P Egusquiaguirre et al.
Neoplasia (New York, N.Y.), 20(5), 489-498 (2018-04-06)
The transcription factor STAT3 is activated inappropriately in 70% of breast cancers, most commonly in triple negative breast cancer (TNBC). Although the transcriptional function of STAT3 is essential for tumorigenesis, the key target genes regulated by STAT3 in driving tumor
Ruizhe Zhao et al.
Cell proliferation, 51(3), e12415-e12415 (2017-12-02)
Urinary tract infection, urinary frequency, urgency, urodynia and haemorrhage are common post-operative complications of thulium laser resection of the prostate (TmLRP). Our study mainly focuses on the role of finasteride in prostate wound healing through AR signalling. TmLRP beagles were

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.