Direkt zum Inhalt
Merck
Alle Fotos(1)

Key Documents

EHU053891

Sigma-Aldrich

MISSION® esiRNA

targeting human TET1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise
Alle Fotos(1)

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

AAAAGACCTCCAAGACCCAAACTTACAGGGAGAGCCACCAAAACTTAATCACTGTCCATCTTTGGAAAAACAAAGTTCATGCAACACGGTGGTTTTCAATGGGCAAACTACTACCCTTTCCAACTCACATATCAACTCAGCTACTAACCAAGCATCCACAAAGTCACATGAATATTCAAAAGTCACAAATTCATTATCTCTTTTTATACCAAAATCAAATTCATCCAAGATTGACACCAATAAAAGTATTGCTCAAGGGATAATTACTCTTGACAATTGTTCCAATGATTTGCATCAGTTGCCACCAAGAAATAATGAAGTGGAGTATTGCAACCAGTTACTGGACAGCAGCAAAAAATTGGACTCAGATGATCTATCATGTCAGGATGCAACCCATACC

Ensembl | Human Hinterlegungsnummer

ENSG00000138336

NCBI-Hinterlegungsnummer

NM_030625

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

human ... TET1(80312) , TET1(80312)

Allgemeine Beschreibung

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable

Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Xi Han et al.
Cell biology international, 41(4), 405-414 (2017-02-06)
The development of chemo-resistance impairs the outcome of the first line platinum-based chemotherapies for ovarian cancer. Deregulation of DNA methylation/demethylation provides a critical mechanism for the occurrence of chemo-resistance. The ten-eleven translocation (TET) family of dioxygenases including TET1/2/3 plays an
Li Gao et al.
International journal of biological sciences, 16(8), 1324-1334 (2020-03-27)
Myostatin (MSTN) is mostly expressed in skeletal muscle and plays crucial roles in the negative regulation of muscle mass development. The methylation and demethylation of myogenesis-specific genes are major regulatory factors in muscle satellite cell differentiation. The present study was
Bo Hu et al.
Journal of cellular biochemistry, 120(4), 6330-6338 (2018-10-27)
Long noncoding RNAs (lncRNAs) have been reported to take part in intracellular RNA regulatory networks and play important roles in a lot of pathological processes. Currently, lncRNA X-inactive specific transcript (XIST) has been proved to regulate cell migration, proliferation, and
Piotr T Filipczak et al.
Cancer research, 79(8), 1758-1768 (2019-01-10)
The role of transcriptional regulator ten-eleven translocation methylcytosine dioxygenease 1 (TET1) has not been well characterized in lung cancer. Here we show that TET1 is overexpressed in adenocarcinoma and squamous cell carcinomas. TET1 knockdown reduced cell growth in vitro and
Yanlan Huang et al.
International journal of molecular sciences, 20(8) (2019-04-27)
Tet-eleven translocation 1 (TET1) is a dioxygenase that plays an important role in decreasing the abundance of DNA methylation and changing the expression levels of specific genes related to inflammation. Porphyromonas gingivalis (Pg.) lipopolysaccharide (LPS) can induce periodontal diseases that
Alle zugehörigen Dokumente anzeigen

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.