Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU109691

Sigma-Aldrich

MISSION® esiRNA

targeting human HSPA5

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Check Cart for Availability
Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Check Cart for Availability

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CTATGAAGCCCGTCCAGAAAGTGTTGGAAGATTCTGATTTGAAGAAGTCTGATATTGATGAAATTGTTCTTGTTGGTGGCTCGACTCGAATTCCAAAGATTCAGCAACTGGTTAAAGAGTTCTTCAATGGCAAGGAACCATCCCGTGGCATAAACCCAGATGAAGCTGTAGCGTATGGTGCTGCTGTCCAGGCTGGTGTGCTCTCTGGTGATCAAGATACAGGTGACCTGGTACTGCTTGATGTATGTCCCCTTACACTTGGTATTGAAACTGTGGGAGGTGTCATGACCAAACTGATTCCAAGGAACACAGTGGTGCCTACCAAGAAGTCTCAGATCTTTTCTACAGCTTCTGATAATCAACCAACTGTTACAATCAAGGTCTATGAAGGTGAAAGACCCCTGACAAA

Ensembl | Número de adesão de ser humano

ENSG00000044574

nº de adesão NCBI

NM_005347

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... HSPA5(3309) , HSPA5(3309)

Categorias relacionadas

Descrição geral

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
BBV
VNU
YJU
VFU
QEU

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Hiroshi Kokubun et al.
International journal of molecular sciences, 21(2) (2020-01-16)
Preclinical studies have shown that exposure of the developing brain to inhalational anesthetics can cause neurotoxicity. However, other studies have claimed that anesthetics can exert neuroprotective effects. We investigated the mechanisms associated with the neurotoxic and neuroprotective effects exerted by
Kyung-Won Park et al.
Scientific reports, 7, 44723-44723 (2017-03-24)
Prion diseases are fatal neurodegenerative disorders affecting several mammalian species, characterized by the accumulation of the misfolded form of the prion protein, which is followed by the induction of endoplasmic reticulum (ER) stress and the activation of the unfolded protein
Haopeng Yang et al.
Oncotarget, 7(50), 83641-83656 (2016-11-16)
Pancreatic cancer is a highly aggressive malignancy, which is intrinsically resistant to current chemotherapies. Herein, we investigate whether bisdemethoxycurcumin (BDMC), a derivative of curcumin, potentiates gemcitabine in human pancreatic cancer cells. The result suggests that BDMC sensitizes gemcitabine by inducing
Patricia Dauer et al.
Molecular oncology, 12(9), 1498-1512 (2018-05-09)
Chemoresistance is a major therapeutic challenge that plays a role in the poor statistical outcomes in pancreatic cancer. Unfolded protein response (UPR) is one of the homeostasis mechanisms in cancer cells that have been correlated with chemoresistance in a number
Jingle Xi et al.
Oncology letters, 15(6), 9861-9867 (2018-05-29)
Glucose-regulated protein 78 (GRP78) is an endoplasmic reticulum stress signaling regulator with anti-apoptotic properties. It has been demonstrated to promote tumor proliferation, survival and metastasis, and to confer resistance against a large variety of therapies. CD24 is a glycosyl-phosphatidylinositol-anchored protein
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica