Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU062731

Sigma-Aldrich

MISSION® esiRNA

targeting human PHF8

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em21 de maio de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em21 de maio de 2025

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

CCTCGCCATCATTCACTGTGAGGGATGTTGAACACTATGTTGGTTCTGACAAAGAGATTGATGTGATTGATGTGACCCGCCAGGCTGACTGCAAGATGAAGCTTGGTGATTTTGTGAAATACTATTACAGCGGGAAGAGGGAGAAAGTCCTCAATGTCATTAGTTTGGAATTCTCTGATACCAGACTTTCTAACCTTGTGGAGACACCGAAGATTGTTCGAAAGCTGTCATGGGTCGAAAACTTGTGGCCAGAGGAATGTGTCTTTGAGAGACCCAATGTACAGAAGTACTGCCTCATGAGTGTGCGAGATAGCTATACAGACTTTCACATTGACTTTGGTGGCACCTCTGTCTGGTACCATGTACTCAAGGGTGAAAAGATCTTCTACCTGATCCGCCCAACAAATGCCAATCTGACTCTCTTTGAGTGCTGGAGCAGTTCCTCTAATCAGAATGAGATGTTCTTTGGGGACCA

Ensembl | Número de adesão de ser humano

ENSG00000172943

nº de adesão NCBI

NM_015107

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... PHF8(23133) , PHF8(23133)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
XZU
ZYU
OWU
BWR
QCS

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Ming-Zhi Cai et al.
Technology in cancer research & treatment, 19, 1533033820967472-1533033820967472 (2020-10-29)
Plant homeodomain finger protein 8 (PHF8) has been reported to participate in cancer development and metastasis of various types of tumors. However, little is known about the functional mechanism of PHF8 in gastric cancer (GC). This study aimed to explore
D Tong et al.
Oncogenesis, 5(12), e283-e283 (2016-12-20)
Recent studies provide strong evidence that the androgen receptor (AR) signaling pathway remains active in castration-resistant prostate cancer (CRPC). However, the underlying mechanisms are not well understood. In this study, we demonstrate that plant homeo domain finger protein 8 (PHF8
Peterson Kariuki Maina et al.
Oncotarget, 7(46), 75585-75602 (2016-10-01)
Epigenetic factors play critical roles in prostate cancer (PCa) development. However, how they contribute to neuroendocrine differentiation (NED) and castration-resistant PCa (CRPC) is not fully understood. Using bioinformatics and biochemical approaches to analyze cell-based models of NED and CRPC, we
Matthias S Leisegang et al.
FEBS letters, 593(5), 487-498 (2019-02-14)
Histone3-lysine9 (H3K9) residues not only control gene expression, but also contribute to RNA splicing. Here, the H3K9 histone demethylase PHF8 was investigated in endothelial cells for its involvement in alternative splicing. An angiogenic sprouting assay shows the importance of PHF8
Peterson Kariuki Maina et al.
Biochimica et biophysica acta. Gene regulatory mechanisms, 1860(9), 1002-1012 (2017-07-25)
Hypoxia through transcription factor HIF1α plays a critical role in cancer development. In prostate cancer, HIF1α interplays with androgen receptor (AR) to contribute to the progression of this disease to its lethal form-castration-resistant prostate cancer (CRPC). Hypoxia upregulates several epigenetic
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica