Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos Principais

EHU044111

Sigma-Aldrich

MISSION® esiRNA

targeting human MFN2

Faça loginpara ver os preços organizacionais e de contrato

Selecione um tamanho

20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

R$ 1.765,00

Previsão de entrega em24 de abril de 2025

Todas as fotos(1)

Selecione um tamanho

Alterar visualização
20 μG
R$ 1.765,00
50 μG
R$ 3.150,00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

R$ 1.765,00

Previsão de entrega em24 de abril de 2025

descrição

Powered by Eupheria Biotech

Nível de qualidade

100

linha de produto

MISSION®

Formulário

lyophilized powder

sequência-alvo de DNAc esiRNA

AGATCAGGCGCCTCTCTGTACTGGTGGACGATTACCAGATGGACTTCCACCCTTCTCCAGTAGTCCTCAAGGTTTATAAGAATGAGCTGCACCGCCACATAGAGGAAGGACTGGGTCGAAACATGTCTGACCGCTGCTCCACGGCCATCACCAACTCCCTGCAGACCATGCAGCAGGACATGATAGATGGCTTGAAACCCCTCCTTCCTGTGTCTGTGCGGAGTCAGATAGACATGCTGGTCCCACGCCAGTGCTTCTCCCTCAACTATGACCTAAACTGTGACAAGCTGTGTGCTGACTTCCAGGAAGACATTGAGTTCCATTTCTCTCTCGGATGGACCATGCTGGTGAATAGGTTCCTGGGCCCCAAGAACAGCCGTCGGGCCTTGATGGGCTACAATGACCA

Ensembl | Número de adesão de ser humano

ENSG00000116688

nº de adesão NCBI

NM_014874

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... MFN2(9927) , MFN2(9927)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Escolha uma das versões mais recentes:

Certificados de análise (COA)

Lot/Batch Number
VLU
MFU
ZQR

Não está vendo a versão correta?

Se precisar de uma versão específica, você pode procurar um certificado específico pelo número do lote ou da remessa.

Pesquise por COA

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Yong Sun Lee et al.
Cancer letters, 433, 156-164 (2018-07-10)
Parkin, a critical gene of Parkinson's disease, is involved in the development of numerous cancers. However, the effect of parkin deficiency on melanoma growth and metastasis has not been reported. We showed that the tumor size and number of surface
Jihong Dong et al.
Journal of dairy science, 103(6), 5561-5574 (2020-04-13)
Inflammation is critical in the progression from benign hepatic lipidosis to pathological hepatic steatosis. The objective of this study was to examine the potential role of the outer mitochondrial membrane protein mitofusin 2 (MFN2) in the etiology of hepatic steatosis
Hongcai Cai et al.
Placenta, 70, 34-40 (2018-10-15)
Miscarriage is a common complication during pregnancy. Mitofusin-2 (MFN2) deficiency in trophoblastic cells is reported to be an important cause for early miscarriage. MFN2 can regulate mitochondrial autophagy, although the mechanisms remain unknown. This study aims to investigate the roles
Rui Zhang et al.
Molecular and cellular endocrinology, 452, 33-43 (2017-05-11)
This study was performed to investigate the oxidative stress-induced miRNA changes in relation to pathogenesis of diabetic retinopathy (DR) and to establish a functional link between miRNAs and oxidative stress-induced retinal endothelial cell injury. Our results demonstrated that oxidative stress
S Givvimani et al.
International journal of cardiology, 187, 325-333 (2015-04-05)
Mitochondria constitute 30% of cell volume and are engaged in two dynamic processes called fission and fusion, regulated by Drp-1 (dynamin related protein) and mitofusin 2 (Mfn2). Previously, we showed that Drp-1 inhibition attenuates cardiovascular dysfunction following pressure overload in
Exibir todos os documentos relacionados

Questions

Reviews

No rating value

Active Filters

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica