Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU039071

Sigma-Aldrich

MISSION® esiRNA

targeting human AHR, RP11-507K12.1

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CTTCCAAGCGGCATAGAGACCGACTTAATACAGAGTTGGACCGTTTGGCTAGCCTGCTGCCTTTCCCACAAGATGTTATTAATAAGTTGGACAAACTTTCAGTTCTTAGGCTCAGCGTCAGTTACCTGAGAGCCAAGAGCTTCTTTGATGTTGCATTAAAATCCTCCCCTACTGAAAGAAACGGAGGCCAGGATAACTGTAGAGCAGCAAATTTCAGAGAAGGCCTGAACTTACAAGAAGGAGAATTCTTATTACAGGCTCTGAATGGCTTTGTATTAGTTGTCACTACAGATGCTTTGGTCTTTTATGCTTCTTCTACTATACAAGATTATCTAGGGTTTCAGCAGTCTGATGTCATACATCAGAGTGTATATGAACTTATCCATACCGAAGACCGAGCTGAATTTC

Ensembl | Número de adesão de ser humano

ENSG00000106546

nº de adesão NCBI

NM_001621

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... AHR(196) , AHR(196)

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Sean A Piwarski et al.
Biochemical pharmacology, 174, 113845-113845 (2020-02-08)
The aryl hydrocarbon receptor (AHR) is a ligand-activated transcription factor. Triple negative breast cancer (TNBC) is the most aggressive breast cancer subtype. TNBC expresses AHR and AHR ligands have anti-cancer activity in TNBC. The aggressiveness of TNBC is due in
Yaxin Zhang et al.
Biomolecules & therapeutics, 25(2), 202-212 (2016-11-11)
Doxorubicin (DOX) is a highly effective chemotherapeutic agent; however, the dose-dependent cardiotoxicity associated with DOX significantly limits its clinical application. In the present study, we investigated whether Rb1 could prevent DOX-induced apoptosis in H9C2 cells
Collynn F Woeller et al.
The American journal of pathology, 186(12), 3189-3202 (2016-11-16)
Thyroid eye disease (TED) is a degenerative disease that manifests with detrimental tissue remodeling, myofibroblast accumulation, and scarring in the orbit of affected individuals. Currently, there are no effective therapies for TED that target or prevent the excessive tissue remodeling
Guillaume Lano et al.
International journal of molecular sciences, 21(7) (2020-04-05)
Endogenous agonists of the transcription factor aryl hydrocarbon receptor (AHR) such as the indolic uremic toxin, indoxyl sulfate (IS), accumulate in patients with chronic kidney disease. AHR activation by indolic toxins has prothrombotic effects on the endothelium, especially via tissue
Yuka Tanaka et al.
Antioxidants (Basel, Switzerland), 9(6) (2020-06-13)
Benzo[a]pyrene (BaP), a major environmental pollutant, activates aryl hydrocarbon receptor (AHR), induces its cytoplasmic-to-nuclear translocation and upregulates the production of cytochrome P450 1A1 (CYP1A1), a xenobiotic metabolizing enzyme which metabolize BaP. The BaP-AHR-CYP1A1 axis generates reactive oxygen species (ROS) and
Exibir todos os documentos relacionados

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica