Pular para o conteúdo
Merck
Todas as fotos(1)

Documentos

EHU007551

Sigma-Aldrich

MISSION® esiRNA

targeting human LCN2

Faça loginpara ver os preços organizacionais e de contrato
Todas as fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descrição

Powered by Eupheria Biotech

linha de produto

MISSION®

forma

lyophilized powder

sequência-alvo de DNAc esiRNA

CAATTCCAGGGGAAGTGGTATGTGGTAGGCCTGGCAGGGAATGCAATTCTCAGAGAAGACAAAGACCCGCAAAAGATGTATGCCACCATCTATGAGCTGAAAGAAGACAAGAGCTACAATGTCACCTCCGTCCTGTTTAGGAAAAAGAAGTGTGACTACTGGATCAGGACTTTTGTTCCAGGTTGCCAGCCCGGCGAGTTCACGCTGGGCAACATTAAGAGTTACCCTGGATTAACGAGTTACCTCGTCCGAGTGGTGAGCACCAACTACAACCAGCATGCTATGGTGTTCTTCAAGAAAGTTTCTCAAAACAGGGAGTACTTCAAGATCACCCTCTACGGGAGAACCAAGGAGCTGACTTCGGAACTAAAGGAGAACTTCATCCGCTTCTCCAAATCTCTGGGCCTCCCTGAAAACCACATCGTCTTCCCTGTC

Ensembl | Número de adesão de ser humano

ENSG00000148346

nº de adesão NCBI

NM_005564

Condições de expedição

ambient

temperatura de armazenamento

−20°C

Informações sobre genes

human ... LCN2(3934) , LCN2(3934)

Categorias relacionadas

Descrição geral

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informações legais

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de classe de armazenamento

10 - Combustible liquids

Ponto de fulgor (°F)

Not applicable

Ponto de fulgor (°C)

Not applicable

Certificados de análise (COA)

Busque Certificados de análise (COA) digitando o Número do Lote do produto. Os números de lote e remessa podem ser encontrados no rótulo de um produto após a palavra “Lot” ou “Batch”.

Já possui este produto?

Encontre a documentação dos produtos que você adquiriu recentemente na biblioteca de documentos.

Visite a Biblioteca de Documentos

Se-Lim Kim et al.
Cancer science, 108(11), 2176-2186 (2017-09-01)
Lipocalin 2 (LCN2), a member of the lipocalin superfamily, plays an important role in oncogenesis and progression in various types of cancer. However, the expression pattern and functional role of LCN2 in colorectal cancer (CRC) is still poorly understood. The
Bilge Ören et al.
The Journal of pathology, 239(3), 274-285 (2016-04-03)
Tumour cell-secreted factors skew infiltrating immune cells towards a tumour-supporting phenotype, expressing pro-tumourigenic mediators. However, the influence of lipocalin-2 (Lcn2) on the metastatic cascade in the tumour micro-environment is still not clearly defined. Here, we explored the role of stroma-derived
Ioanna Mosialou et al.
The Journal of experimental medicine, 217(10) (2020-07-09)
Regulation of food intake is a recently identified endocrine function of bone that is mediated by Lipocalin-2 (LCN2). Osteoblast-secreted LCN2 suppresses appetite and decreases fat mass while improving glucose metabolism. We now show that serum LCN2 levels correlate with insulin
Masafumi Okuda et al.
Oncotarget, 8(21), 34670-34677 (2017-04-15)
Esophageal cancer is the eighth most common cancer and the sixth most common cause of cancer-related deaths worldwide. Despite the research progress in understanding the disease, the mechanism underlying the metastasis is still unclear. Here, we successfully generated a highly
Peng Guo et al.
Theranostics, 6(1), 1-13 (2016-01-02)
Lipocalin 2 (Lcn2) is a promising therapeutic target as well as a potential diagnostic biomarker for breast cancer. It has been previously shown to promote breast cancer progression by inducing the epithelial to mesenchymal transition in breast cancer cells as

Nossa equipe de cientistas tem experiência em todas as áreas de pesquisa, incluindo Life Sciences, ciência de materiais, síntese química, cromatografia, química analítica e muitas outras.

Entre em contato com a assistência técnica