Accéder au contenu
Merck
Toutes les photos(1)

Key Documents

EHU139421

Sigma-Aldrich

MISSION® esiRNA

targeting human CTNNB1

Se connecterpour consulter vos tarifs contractuels et ceux de votre entreprise/organisme
Toutes les photos(1)

About This Item

Code UNSPSC :
41105324
Nomenclature NACRES :
NA.51

Description

Powered by Eupheria Biotech

Niveau de qualité

100

Gamme de produits

MISSION®

Forme

lyophilized powder

Séquence cible d'ADNc esiRNA

GCCGGCTATTGTAGAAGCTGGTGGAATGCAAGCTTTAGGACTTCACCTGACAGATCCAAGTCAACGTCTTGTTCAGAACTGTCTTTGGACTCTCAGGAATCTTTCAGATGCTGCAACTAAACAGGAAGGGATGGAAGGTCTCCTTGGGACTCTTGTTCAGCTTCTGGGTTCAGATGATATAAATGTGGTCACCTGTGCAGCTGGAATTCTTTCTAACCTCACTTGCAATAATTATAAGAACAAGATGATGGTCTGCCAAGTGGGTGGTATAGAGGCTCTTGTGCGTACTGTCCTTCGGGCTGGTGACAGGGAAGACATCACTGAGCCTGCCATCTGTGCTCTTCGTCATCTGACCAGCCGACACCAAGAAGCAGAGATGGCCCAGAATGCAGTTCGCCTTCACTATGGACTACCAGTTGTGGTTAAGCTCTTACACCCACCATCCCACT

Numéro d'accès Ensembl | humain

ENSG00000168036

Numéro d'accès NCBI

NM_001098209

Conditions d'expédition

ambient

Température de stockage

−20°C

Informations sur le gène

human ... CTNNB1(1499) , CTNNB1(1499)

Description générale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informations légales

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Code de la classe de stockage

10 - Combustible liquids

Point d'éclair (°F)

Not applicable

Point d'éclair (°C)

Not applicable

Certificats d'analyse (COA)

Recherchez un Certificats d'analyse (COA) en saisissant le numéro de lot du produit. Les numéros de lot figurent sur l'étiquette du produit après les mots "Lot" ou "Batch".

Déjà en possession de ce produit ?

Retrouvez la documentation relative aux produits que vous avez récemment achetés dans la Bibliothèque de documents.

Consulter la Bibliothèque de documents

Nianchun Hu et al.
Biochemical and biophysical research communications, 533(4), 1457-1463 (2020-12-04)
Oxycodone is a common type of opioid used for the treatment of moderate to severe pain. Besides its analgesic effects on neuron cells, the effects of oxycodone on other cell types are yet to be elucidated. We previously demonstrated that
Peng Kong et al.
Oncotarget, 8(70), 115089-115101 (2018-02-01)
Microwave ablation (MWA), a thermal ablation, is an effective treatment for breast cancer. However, residual breast cancer is still detected. The biological characteristics of residual breast cancer after thermal ablation remain unknown. To mimic insufficient MWA
Miguel Ángel Sarabia-Sánchez et al.
Frontiers in oncology, 10, 1039-1039 (2020-08-09)
ALDH is an enzyme involved in different cellular processes, including cancer. It has been shown that a cellular subpopulation with high ALDH activity (ALDHHIGH) within a tumor is related to functional capabilities such as stemness, chemoresistance, and tumorigenicity. However, few
Izabela Janus et al.
Acta veterinaria Hungarica, 64(1), 90-102 (2016-02-27)
Primary heart tumours affect less than 1% of dogs. Due to their rare incidence, every research showing the frequency of cardiac tumours is valuable. Routine diagnostics is often complemented with immunohistochemical analysis. This study was conducted on 110 patient records
Xuejie Jiang et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 24(10), 2417-2429 (2018-02-22)
Purpose: Wnt/β-catenin signaling is required for leukemic stem cell function. FLT3 mutations are frequently observed in acute myeloid leukemia (AML). Anomalous FLT3 signaling increases β-catenin nuclear localization and transcriptional activity. FLT3 tyrosine kinase inhibitors (TKI) are used clinically to treat
Afficher tous les articles scientifiques apparentés

Notre équipe de scientifiques dispose d'une expérience dans tous les secteurs de la recherche, notamment en sciences de la vie, science des matériaux, synthèse chimique, chromatographie, analyse et dans de nombreux autres domaines..

Contacter notre Service technique