Direkt zum Inhalt
Merck

EHU148801

Sigma-Aldrich

MISSION® esiRNA

targeting human YBX1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise

Größe auswählen

20 μG
€ 197,00
50 μG
€ 349,00

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)


Größe auswählen

Ansicht ändern
20 μG
€ 197,00
50 μG
€ 349,00

About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

€ 197,00


Versand in der Regel in 1 Woche. (Bei Bestellungen außerhalb der USA und Europas rechnen Sie bitte zusätzlich 1-2 Wochen für die Lieferung ein)

Beschreibung

Powered by Eupheria Biotech

Qualitätsniveau

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATGCCGGCTTACCATCTCTACCATCATCCGGTTTAGTCATCCAACAAGAAGAAATATGAAATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCAGCATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAATTGTTTCATATCTGGTCAAGTTGAGATTTTTAAGAACTTCATTTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAAAGTCAACAAACTGCAAGCACCTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Hier finden Sie alle aktuellen Versionen:

Analysenzertifikate (COA)

Lot/Batch Number

Die passende Version wird nicht angezeigt?

Wenn Sie eine bestimmte Version benötigen, können Sie anhand der Lot- oder Chargennummer nach einem spezifischen Zertifikat suchen.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Aneri Shah et al.
Cancers, 12(8) (2020-08-09)
Cell fate decisions regulating survival and death are essential for maintaining tissue homeostasis; dysregulation thereof can lead to tumor development. In some cases, survival and death are triggered by the same receptor, e.g., tumor necrosis factor (TNF)-receptor 1 (TNFR1). We
Konstanze Lettau et al.
International journal of radiation oncology, biology, physics, 109(2), 567-580 (2020-09-16)
Y-box binding protein 1 (YB-1) overexpression is associated with chemotherapy- and radiation therapy resistance. Ionizing radiation (IR), receptor tyrosine kinase ligands, and mutation in KRAS gene stimulate activation of YB-1. YB-1 accelerates the repair of IR-induced DNA double-strand breaks (DSBs).
Cristina Pagano et al.
Oncotarget, 8(4), 6193-6205 (2016-12-23)
Correct spatial and temporal control of cell proliferation is of fundamental importance for tissue homeostasis. Its deregulation has been associated with several pathological conditions. In common with almost every aspect of plant and animal biology, cell proliferation is dominated by
Jinjing Jia et al.
Molecular medicine reports, 15(1), 240-248 (2016-12-07)
The cathelicidin antimicrobial peptide, LL-37, is a multifunctional peptide with a broad spectrum of antimicrobial activities, such as chemotaxis and neutralizing endotoxins. Previous studies have demonstrated that it LL‑37 serves a functional role in the development of numerous types of
Xueming Cao et al.
Free radical biology & medicine, 141, 10-20 (2019-06-04)
Y-box protein 1 (YB1) is a key regulator of inflammatory mediators. However, the roles of YB1 in oxidized low-density lipoprotein (ox-LDL)-induced macrophage inflammation and lipid uptake remain less understood. Thus, we explored the roles of YB1 in ox-LDL-induced macrophage inflammation

Questions

Reviews

No rating value

Active Filters

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.