Direkt zum Inhalt
Merck

EHU144451

Sigma-Aldrich

MISSION® esiRNA

targeting human NUPR1

Anmeldenzur Ansicht organisationsspezifischer und vertraglich vereinbarter Preise


About This Item

UNSPSC-Code:
41105324
NACRES:
NA.51

Beschreibung

Powered by Eupheria Biotech

Produktlinie

MISSION®

Form

lyophilized powder

esiRNA cDNA-Zielsequenz

GAAGAGAGGCAGGGAAGACAAGCCAGGCACGATGGCCACCTTCCCACCAGCAACCAGCGCCCCCCAGCAGCCCCCAGGCCCGGAGGACGAGGACTCCAGCCTGGATGAATCTGACCTCTATAGCCTGGCCCATTCCTACCTCGGAGGTGGAGGCCGGAAAGGTCGCACCAAGAGAGAAGCTGCTGCCAACACCAACCGCCCCAGCCCTGGCGGGCACGAGAGGAAACTGGTGACCAAGCTGCAGAATTCAGAGAGGAAGAAGCGAGGGGCACGGCGCTGAGACAGAGCTGGAGATGAGGCCAGACCATGGACACTACACCCAGCAATAGAGACGGGACTGCGGAGGAAGGAGGACCCAGGACAGGATCCAGGCCGGCTTGCCACACCCCCCACCCCTAGGACTTATTCCCGCTGACTGAGTCTCTGAGGGGCTACCAGGAAAGCGCCTCCAACCCTAGCAAAAGTGCAAGATGGGGAGTG

Ensembl | Human Hinterlegungsnummer

NCBI-Hinterlegungsnummer

Versandbedingung

ambient

Lagertemp.

−20°C

Angaben zum Gen

Allgemeine Beschreibung

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Rechtliche Hinweise

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Lagerklassenschlüssel

10 - Combustible liquids

Flammpunkt (°F)

Not applicable

Flammpunkt (°C)

Not applicable


Analysenzertifikate (COA)

Suchen Sie nach Analysenzertifikate (COA), indem Sie die Lot-/Chargennummer des Produkts eingeben. Lot- und Chargennummern sind auf dem Produktetikett hinter den Wörtern ‘Lot’ oder ‘Batch’ (Lot oder Charge) zu finden.

Besitzen Sie dieses Produkt bereits?

In der Dokumentenbibliothek finden Sie die Dokumentation zu den Produkten, die Sie kürzlich erworben haben.

Die Dokumentenbibliothek aufrufen

Ki-Sun Kim et al.
Anatomy & cell biology, 45(1), 17-25 (2012-04-27)
Nuclear protein-1 (NUPR1) is a small nuclear protein that is responsive to various stress stimuli. Although NUPR1 has been associated with cancer development, its expression and roles in cholangiocarcinoma have not yet been described. In the present study, we found
Patricia M Schnepp et al.
Molecular cancer research : MCR, 18(9), 1290-1301 (2020-06-10)
The majority of patients with prostate cancer treated with docetaxel develop resistance to it. To better understand the mechanism behind the acquisition of resistance, we conducted single-cell RNA-sequencing (scRNA-seq) of docetaxel-sensitive and -resistant variants of DU145 and PC3 prostate cancer
Anthony Murphy et al.
Oncology reports, 45(4) (2021-03-03)
Nickel (Ni) is carcinogenic to humans, and causes cancers of the lung, nasal cavity, and paranasal sinuses. The primary mechanisms of Ni‑mediated carcinogenesis involve the epigenetic reprogramming of cells and the ability for Ni to mimic hypoxia. However, the exact
Yanchao Mu et al.
Autophagy, 14(4), 654-670 (2017-11-14)
In the advanced stages of cancer, autophagy is thought to promote tumor progression through its ability to mitigate various cellular stresses. However, the details of how autophagy is homeostatically regulated in such tumors are unknown. Here, we report that NUPR1

Unser Team von Wissenschaftlern verfügt über Erfahrung in allen Forschungsbereichen einschließlich Life Science, Materialwissenschaften, chemischer Synthese, Chromatographie, Analytik und vielen mehr..

Setzen Sie sich mit dem technischen Dienst in Verbindung.