Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU137721

Sigma-Aldrich

MISSION® esiRNA

targeting human GATA3

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych

Wybierz wielkość

20 μG
1060,00 zł
50 μG
1910,00 zł

1060,00 zł

Skontaktuj się z Obsługą Klienta, aby uzyskać informacje na temat dostępności
Wszystkie zdjęcia(1)

Wybierz wielkość

Zmień widok
20 μG
1060,00 zł
50 μG
1910,00 zł

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

1060,00 zł

Skontaktuj się z Obsługą Klienta, aby uzyskać informacje na temat dostępności

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GGACGAGAAAGAGTGCCTCAAGTACCAGGTGCCCCTGCCCGACAGCATGAAGCTGGAGTCGTCCCACTCCCGTGGCAGCATGACCGCCCTGGGTGGAGCCTCCTCGTCGACCCACCACCCCATCACCACCTACCCGCCCTACGTGCCCGAGTACAGCTCCGGACTCTTCCCCCCCAGCAGCCTGCTGGGCGGCTCCCCCACCGGCTTCGGATGCAAGTCCAGGCCCAAGGCCCGGTCCAGCACAGGCAGGGAGTGTGTGAACTGTGGGGCAACCTCGACCCCACTGTGGCGGCGAGATGGCACGGGACACTACCTGTGCAACGCCTGCGGGCTCTATCACAAAATGAACGGACAGAACCGGCCCCTCATTAAGCCCAAGCGAAGGCTGTCTGCAGCCAGGAGAGCAGGGACGTCCTGTGCGAACTGTCAGAC

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000107485

numer dostępu NCBI

NM_001002295

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... GATA3(2625) , GATA3(2625)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number
DEV
SHU
LWT
XST
FST

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Wyszukaj dokument COA

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Yinghua Xu et al.
Oncotarget, 8(66), 110517-110529 (2018-01-05)
Lung adenocarcinoma (LAC) is the leading cause of cancer-related death worldwide. Aberrant expression of genes expressed preferentially in the lung tumor vasculature may yield clues for prognosis and treatment. Von Willebrand factor (vWF) is a large multifunctional glycoprotein with a
Shuangqin Wei et al.
Cancer management and research, 9, 769-780 (2017-12-22)
GATA3, a member of the GATA zinc finger transcription factor family, has been widely investigated for its role in cancer. Although a recent report has found that GATA3 is downregulated in gastric cancer (GC), the detailed mechanism of GATA3 in
Linjie Ma et al.
OncoTargets and therapy, 11, 7579-7589 (2018-11-23)
GATA3 functions as a tumor suppressor and has been observed in multiple types of cancer, but the effects and mechanisms of GATA3 in osteosarcoma (OS) are not yet known. The GATA3 expression in OS cells and tissues were detected using
Amr Ahmed El-Arabey et al.
Cellular signalling, 68, 109539-109539 (2020-01-15)
High-grade serous ovarian carcinoma (HGSOC) is the most lethal gynecologic cancer. Emerging evidence suggests that tumor-associated macrophages (TAMs) play an immunosuppressive role in the tumor microenvironment and promote tumor growth, angiogenesis, and metastasis in ovarian cancer. Therefore, targeting TAMs in
Mingjun Bi et al.
Nature cell biology, 22(6), 701-715 (2020-05-20)
Acquired therapy resistance is a major problem for anticancer treatment, yet the underlying molecular mechanisms remain unclear. Using an established breast cancer cellular model, we show that endocrine resistance is associated with enhanced phenotypic plasticity, indicated by a general downregulation
Wyświetl wszystkie powiązane dokumenty

Questions

Reviews

No rating value

Active Filters

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej