Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Key Documents

EHU131291

Sigma-Aldrich

MISSION® esiRNA

targeting human MTA1

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

ATGGAGGAGTGGTCTGCATCAGAGGCCAACCTTTTCGAGGAAGCCCTGGAAAAATATGGGAAGGATTTCACGGACATTCAGCAAGATTTTCTCCCGTGGAAGTCGCTGACCAGCATCATTGAGTACTACTACATGTGGAAGACCACCGACAGATACGTGCAGCAGAAACGCTTGAAAGCAGCTGAAGCTGAGAGCAAGTTAAAGCAAGTTTATATTCCCAACTATAACAAGCCAAATCCGAACCAAATCAGCGTCAACAACGTCAAGGCCGGTGTGGTGAACGGCACGGGGGCGCCGGGCCAGAGCCCTGGGGCTGGCCGGGCCTGCGAGAGCTGTTACACCACACAGTCTTACCAGTGGTATTCTTGGGGTCCCCCTAACATGCAGTGTCGTCTCTGCGCATCTTGTTGGACATATTGGAAGAAATATGGTGGCTTGAAAATGCCAACCCGGTTAGATGGAGAGAGGCCAGGA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000182979

numer dostępu NCBI

NM_004689

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... MTA1(9112) , MTA1(9112)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

S Deivendran et al.
Scientific reports, 7, 44225-44225 (2017-04-11)
Despite a recognized role of DNA methyltransferase 3a (DNMT3a) in human cancer, the nature of its upstream regulator(s) and relationship with the master chromatin remodeling factor MTA1, continues to be poorly understood. Here, we found an inverse relationship between the
Yongqin Pan et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 83, 1398-1406 (2016-10-25)
Dysregulation of microRNAs is involved in the initiation and progression of several human cancers, including breast cancer, as strong evidence of miRNAs acting as oncogenes or tumour suppressor genes has been found. This study was performed to investigate the biological
Wenhao Weng et al.
International journal of oncology, 44(3), 812-818 (2014-01-16)
Esophageal squamous cell carcinoma (ESCC) is one of the most common malignant tumors. Upregulation of metastasis-associated protein 1 (MTA1) has been reported to contribute to the development of esophageal squamous cell carcinoma. Therefore, the objective of our study was to identify
Hong Zhang et al.
Acta biochimica et biophysica Sinica, 47(7), 496-503 (2015-05-23)
Metastasis-associated gene 1 (MTA1) is associated with cell growth, metastasis, and survival in non-small-cell lung cancer (NSCLC). Several previous reports have demonstrated that microRNAs affect gene expression through interaction between their seed region and the 3'-untranslated region of the target
Ioannis Sanidas et al.
Molecular cell, 73(5), 985-1000 (2019-02-04)
Hyper-phosphorylation of RB controls its interaction with E2F and inhibits its tumor suppressor properties. However, during G1 active RB can be mono-phosphorylated on any one of 14 CDK phosphorylation sites. Here, we used quantitative proteomics to profile protein complexes formed

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej