Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU111891

Sigma-Aldrich

MISSION® esiRNA

targeting human NANOG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TTCCTTCCTCCATGGATCTGCTTATTCAGGACAGCCCTGATTCTTCCACCAGTCCCAAAGGCAAACAACCCACTTCTGCAGAGAAGAGTGTCGCAAAAAAGGAAGACAAGGTCCCGGTCAAGAAACAGAAGACCAGAACTGTGTTCTCTTCCACCCAGCTGTGTGTACTCAATGATAGATTTCAGAGACAGAAATACCTCAGCCTCCAGCAGATGCAAGAACTCTCCAACATCCTGAACCTCAGCTACAAACAGGTGAAGACCTGGTTCCAGAACCAGAGAATGAAATCTAAGAGGTGGCAGAAAAACAACTGGCCGAAGAATAGCAATGGTGTGACGCAGAAGGCCTCAGCACCTACCTACCCCAGCCTTTACTCTTCCTACCACCAGGGATGCCTGGTGAACCCGACTGGGAACCTTCCAATGTGGAGCAACCAGACCTGGAACAAT

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000111704

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... NANOG(388112) , NANOG(79923)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Li Li et al.
Oncology letters, 17(1), 555-563 (2019-01-19)
NANOGP8 is one of the NANOG pseudogenes and is expressed together with NANOG in multiple tumor tissues and cell lines. The biological functions of NANOGP8 in progression of gastric cancer are unclear. In the present study, the role of NANOGP8
Yuki Katsura et al.
Cancers, 11(2) (2019-02-06)
Excess iron causes cancer and is thought to be related to carcinogenesis and cancer progression including stemness, but the details remain unclear. Here, we hypothesized that stemness in cancer is related to iron metabolism and that regulating iron metabolism in
Khalid Arif et al.
OncoTargets and therapy, 8, 1327-1334 (2015-06-18)
There is an accumulation of evidence that shows a significant role of cancer stem cells in tumor initiation, proliferation, relapse, and metastasis. Nanog is the most important core transcription marker of stem cells, known by its role in maintaining pluripotency

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej