Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU097711

Sigma-Aldrich

MISSION® esiRNA

targeting human PPARG

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

TGAATGTGAAGCCCATTGAAGACATTCAAGACAACCTGCTACAAGCCCTGGAGCTCCAGCTGAAGCTGAACCACCCTGAGTCCTCACAGCTGTTTGCCAAGCTGCTCCAGAAAATGACAGACCTCAGACAGATTGTCACGGAACACGTGCAGCTACTGCAGGTGATCAAGAAGACGGAGACAGACATGAGTCTTCACCCGCTCCTGCAGGAGATCTACAAGGACTTGTACTAGCAGAGAGTCCTGAGCCACTGCCAACATTTCCCTTCTTCCA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000132170

numer dostępu NCBI

NM_015869

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PPARG(5468) , PPARG(5468)

Opis ogólny

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Pradip K Saha et al.
American journal of physiology. Endocrinology and metabolism, 319(4), E667-E677 (2020-08-18)
MicroRNA-30a (miR-30a) impacts adipocyte function, and its expression in white adipose tissue (WAT) correlates with insulin sensitivity in obesity. Bioinformatic analysis demonstrates that miR-30a expression contributes to 2% of all miRNA expression in human tissues. However, molecular mechanisms of miR-30a
Vahid Kheirollahi et al.
Nature communications, 10(1), 2987-2987 (2019-07-07)
Idiopathic pulmonary fibrosis (IPF) is a fatal disease in which the intricate alveolar network of the lung is progressively replaced by fibrotic scars. Myofibroblasts are the effector cells that excessively deposit extracellular matrix proteins thus compromising lung structure and function.
Wenxin Hu et al.
Environmental science & technology, 51(7), 4061-4068 (2017-03-11)
2-Ethylhexyl diphenyl phosphate (EHDPP), an organophosphate flame retardant (OPFR), is frequently detected in human blood. In this study, the sensitive dual-luciferase reporter gene assay and molecular docking were used to investigate the activation of EHDPP to human peroxisome proliferator-activated receptor
Miao Xu et al.
Oncotarget, 8(56), 95914-95930 (2017-12-10)
The poor prognosis of esophageal squamous cell carcinoma (ESCC) emphasizes the urgent need to better understand the carcinogenesis and develop prevention strategies. Previous studies have highlighted the potential of using Vitamin E (tocopherols) for cancer chemoprevention, but the preventive activity

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej