Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Kluczowe dokumenty

EHU082601

Sigma-Aldrich

MISSION® esiRNA

targeting human EXOSC10

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych


About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

linia produktu

MISSION®

Formularz

lyophilized powder

sekwencja docelowa esiRNA cDNA

GCAGATGCAGTGCTTCAAAAGCCACAACCCCAGTTATACAGACCTATAGAAGAGACACCATGCCATTTCATATCCTCCCTGGATGAACTCGTGGAACTCAACGAAAAGCTCTTGAATTGTCAGGAATTTGCAGTTGACTTGGAGCACCACTCTTACAGGAGCTTCCTGGGACTGACCTGCCTGATGCAAATTTCTACTCGGACGGAAGACTTCATCATTGACACCCTCGAGCTTCGAAGTGACATGTACATTCTCAATGAGAGCCTCACAGACCCAGCCATCGTTAAGGTCTTTCATGGTGCTGATTCAGACATAGAATGGCTACAGAAAGACTTTGGGTTGTATGTAGTAAACATGTTTGATACTCATCAGGCAGCACGCCTTCTTAACCTGGGCAGGCACT

Ensembl | numer dostępu dla gatunku człowiek

numer dostępu NCBI

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Ta strona może zawierać tekst przetłumaczony maszynowo.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable


Wybierz jedną z najnowszych wersji:

Certyfikaty analizy (CoA)

Lot/Batch Number

Nie widzisz odpowiedniej wersji?

Jeśli potrzebujesz konkretnej wersji, możesz wyszukać konkretny certyfikat według numeru partii lub serii.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Lee Davidson et al.
Cell reports, 26(10), 2779-2791 (2019-03-07)
Cell-based studies of human ribonucleases traditionally rely on methods that deplete proteins slowly. We engineered cells in which the 3'→5' exoribonucleases of the exosome complex, DIS3 and EXOSC10, can be rapidly eliminated to assess their immediate roles in nuclear RNA biology.
Karla Rubio et al.
Nature communications, 10(1), 2229-2229 (2019-05-22)
Idiopathic pulmonary fibrosis (IPF) is a chronic, progressive, and highly lethal lung disease with unknown etiology and poor prognosis. IPF patients die within 2 years after diagnosis mostly due to respiratory failure. Current treatments against IPF aim to ameliorate patient
Penelope Kroustallaki et al.
Cell reports, 28(7), 1690-1702 (2019-08-15)
Telomerase biogenesis is a complex process where several steps remain poorly understood. Single-strand-selective uracil-DNA glycosylase (SMUG1) associates with the DKC1-containing H/ACA ribonucleoprotein complex, which is essential for telomerase biogenesis. Herein, we show that SMUG1 interacts with the telomeric RNA component
Dan Vershkov et al.
Cell reports, 26(10), 2531-2539 (2019-03-07)
Fragile X syndrome (FXS) is caused primarily by a CGG repeat expansion in the FMR1 gene that triggers its transcriptional silencing. In order to investigate the regulatory layers involved in FMR1 inactivation, we tested a collection of chromatin modulators for

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej