Przejdź do zawartości
Merck
Wszystkie zdjęcia(1)

Dokumenty

EHU059231

Sigma-Aldrich

MISSION® esiRNA

targeting human PARK2

Zaloguj sięWyświetlanie cen organizacyjnych i kontraktowych
Wszystkie zdjęcia(1)

About This Item

Kod UNSPSC:
41105324
NACRES:
NA.51

opis

Powered by Eupheria Biotech

Poziom jakości

100

linia produktu

MISSION®

Postać

lyophilized powder

sekwencja docelowa esiRNA cDNA

AATTCCAAACCGGATGAGTGGTGAATGCCAATCCCCACACTGCCCTGGGACTAGTGCAGAATTTTTCTTTAAATGTGGAGCACACCCCACCTCTGACAAGGAAACATCAGTAGCTTTGCACCTGATCGCAACAAATAGTCGGAACATCACTTGCATTACGTGCACAGACGTCAGGAGCCCCGTCCTGGTTTTCCAGTGCAACTCCCGCCACGTGATTTGCTTAGACTGTTTCCACTTATACTGTGTGACAAGACTCAATGATCGGCAGTTTGTTCACGACCCTCAACTTGGCTACTCCCTGCCTTGTGTGGCTGGCTGTCCCAACTCCTTGATTAAAGAGCTCCATCACTTCAGGATTCTGGGAGAAGAGCAGTACAACCGGTACCAGCAGTATGGTGCAGAGGAGTGTGTCCTGCAGATGGGGGGCGTGTTATGCCCCCGCCCTGGCTGTGGAGCGGGGCTGCTGCCGGAGCCTGACCAGAGGAAAGTCACCTGCGAA

Ensembl | numer dostępu dla gatunku człowiek

ENSG00000185345

numer dostępu NCBI

NM_013988

Warunki transportu

ambient

temp. przechowywania

−20°C

informacje o genach

human ... PARK2(5071) , PARK2(5071)

Opis ogólny

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Informacje prawne

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
This page may contain text that has been machine translated.

Kod klasy składowania

10 - Combustible liquids

Temperatura zapłonu (°F)

Not applicable

Temperatura zapłonu (°C)

Not applicable

Certyfikaty analizy (CoA)

Poszukaj Certyfikaty analizy (CoA), wpisując numer partii/serii produktów. Numery serii i partii można znaleźć na etykiecie produktu po słowach „seria” lub „partia”.

Masz już ten produkt?

Dokumenty związane z niedawno zakupionymi produktami zostały zamieszczone w Bibliotece dokumentów.

Odwiedź Bibliotekę dokumentów

Saburo Ito et al.
Autophagy, 11(3), 547-559 (2015-02-26)
Cigarette smoke (CS)-induced mitochondrial damage with increased reactive oxygen species (ROS) production has been implicated in COPD pathogenesis by accelerating senescence. Mitophagy may play a pivotal role for removal of CS-induced damaged mitochondria, and the PINK1 (PTEN-induced putative kinase 1)-PARK2
Zhengjun Gao et al.
Nature communications, 8(1), 1805-1805 (2017-11-29)
Macrophages, dendritic cells and other innate immune cells are involved in inflammation and host defense against infection. Metabolic shifts in mitochondrial dynamics may be involved in Toll-like receptor agonist-mediated inflammatory responses and immune cell polarization. However, whether the mitochondrial morphology
Vinay Choubey et al.
Autophagy, 10(6), 1105-1119 (2014-06-01)
The autophagy protein BECN1/Beclin 1 is known to play a central role in autophagosome formation and maturation. The results presented here demonstrate that BECN1 interacts with the Parkinson disease-related protein PARK2. This interaction does not require PARK2 translocation to mitochondria
Shu Li et al.
Free radical biology & medicine, 152, 632-649 (2019-12-12)
Mitophagy is a principle mechanism to degrade damaged mitochondria through PARK2-dependent or PARK2-independent pathway. Mitophagy has been identified to play an important role in acute kidney disease, whereas its role in renal fibrosis remains ill-defined. We sought to investigate the
Pedro Elói Antunes Dionísio et al.
Molecular neurobiology, 56(4), 2990-3004 (2018-08-04)
Parkin is an E3 ubiquitin ligase involved in Parkinson's disease (PD). Necroptosis is a regulated form of cell death that depends on receptor interacting protein 1 (RIP1) and 3 (RIP3). Importantly, parkin has been implicated in ubiquitination events that can

Nasz zespół naukowców ma doświadczenie we wszystkich obszarach badań, w tym w naukach przyrodniczych, materiałoznawstwie, syntezie chemicznej, chromatografii, analityce i wielu innych dziedzinach.

Skontaktuj się z zespołem ds. pomocy technicznej