Passa al contenuto
Merck
Tutte le immagini(1)

Documenti

EHU091731

Sigma-Aldrich

MISSION® esiRNA

targeting human MET

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali
Tutte le immagini(1)

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Forma fisica

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

CCACATTGACCTCAGTGCTCTAAATCCAGAGCTGGTCCAGGCAGTGCAGCATGTAGTGATTGGGCCCAGTAGCCTGATTGTGCATTTCAATGAAGTCATAGGAAGAGGGCATTTTGGTTGTGTATATCATGGGACTTTGTTGGACAATGATGGCAAGAAAATTCACTGTGCTGTGAAATCCTTGAACAGAATCACTGACATAGGAGAAGTTTCCCAATTTCTGACCGAGGGAATCATCATGAAAGATTTTAGTCATCCCAATGTCCTCTCGCTCCTGGGAATCTGCCTGCGAAGTGAAGGGTCTCCGCTGGTGGTCCTACCATACATGAAACATGGAGATCTTCGAAATTTCATTCGAAATGAGACTCATAATCCAACTGTAAAAGATCTTATTGGCTTTGGTCTTCAAGTAGCCAAAGGCATGA

N° accesso Ensembl | uomo

ENSG00000105976

N° accesso NCBI

NM_000245

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... MET(4233) , MET(4233)

Descrizione generale

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Certificati d'analisi (COA)

Cerca il Certificati d'analisi (COA) digitando il numero di lotto/batch corrispondente. I numeri di lotto o di batch sono stampati sull'etichetta dei prodotti dopo la parola ‘Lotto’ o ‘Batch’.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Demin Jiao et al.
Journal of cellular and molecular medicine, 22(7), 3526-3536 (2018-04-18)
Hepatocyte growth factor (HGF) overexpression is an important mechanism in acquired epidermal growth factor receptor (EGFR) kinase inhibitor gefitinib resistance in lung cancers with EGFR activating mutations. MiR-1-3p and miR-206 act as suppressors in lung cancer proliferation and metastasis. However
Qian-Qian Liu et al.
Journal of Zhejiang University. Science. B, 21(10), 779-795 (2020-10-13)
Verticillin A is a diketopiperazine compound which was previously isolated from Amanita flavorubescens Alk (containing parasitic fungi Hypomyces hyalines (Schw.) Tul.). Here, we initially found, by wound healing assay and Transwell assay in vitro, that verticillin A possesses an inhibitory
J van de Kamp et al.
Journal of tissue engineering and regenerative medicine, 11(11), 2988-2998 (2016-09-20)
Mesenchymal stem cells (MSC) are precursor cells of mesodermal tissue and, because of their trophic phenotype, they are known to play beneficial roles in wound healing. In addition, various tissue engineering strategies are based on MSC/biomaterial constructs. As the isolation
Jie Zhu et al.
Oncotarget, 8(65), 108665-108675 (2018-01-10)
Tumor necrosis factor-related apoptosis inducing ligand (TRAIL) induces apoptosis in malignant cells, but not in normal cells. As papillary thyroid carcinoma cells broadly expressed TRAIL receptors (death receptor 4 and death receptor 5) on their surface, TRAIL is considered as
Feng-Jie Lin et al.
Molecules and cells, 43(10), 856-869 (2020-10-30)
To elucidate the mechanism of action of HOXA11-AS in modulating the cisplatin resistance of nasopharyngeal carcinoma (NPC) cells. HOXA11-AS and miR-454-3p expression in NPC tissue and cisplatin-resistant NPC cells were measured via quantitative reverse transcriptase polymerase chain reaction. NPC parental
Visualizza tutti i documenti correlati

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.