Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU081461

Sigma-Aldrich

MISSION® esiRNA

targeting human AXL

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali


About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

Descrizione

Powered by Eupheria Biotech

Livello qualitativo

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

TGATCAATTATAGTTTCTGAGGCTTTATGATAATAGATTCTCTTGTATAAGATCCTAGATCCTAAGGGTCGAAAGCTCTAGAATCTGCAATTCAAAAGTTCCAAGAGTCTAAAGATGGAGTTTCTAAGGTCCGGTGTTCTAAGATGTGATATTCTAAGACTTACTCTAAGATCTTAGATTCTCTGTGTCTAAGATTCTAGATCAGATGCTCCAAGATTCTAGATGATTAAATAAGATTCTAACGGTCTGTTCTGTTTCAAGGCACTCTAGATTCCATTGGTCCAAGATTCCGGATCCTAAGCATCTAAGTTATAAGACTCTCACACTCAGTTGTGACTAACTAGACACCAAAGTTCTAATAATTTCTAATGTTGGACACCTTTAGGTTCTTTGCTGCATTCTGC

N° accesso Ensembl | uomo

N° accesso NCBI

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... AXL(558) , AXL(558)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable


Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

Jian-Zhong Lin et al.
Oncotarget, 8(25), 41064-41077 (2017-04-30)
Resistance to docetaxel is a major clinical problem in advanced prostate cancer. The overexpression of AXL receptor tyrosine kinase (AXL) has been correlated with chemotherapeutic drug resistance. However, the role of AXL expression in docetaxel resistance in prostate cancer is
Wenwen Du et al.
Oncology reports, 44(1), 185-195 (2020-04-23)
Gefitinib is currently the preferred treatment for non‑small cell lung cancer (NSCLC) patients with epidermal growth factor receptor (EGFR)‑activating mutation. However, some patients gradually develop acquired resistance after receiving treatment. In addition to secondary T790M mutation, the remaining mechanisms contributing
Nellie K McDaniel et al.
Molecular cancer therapeutics, 17(11), 2297-2308 (2018-08-11)
The TAM (TYRO3, AXL, MERTK) family receptor tyrosine kinases (RTK) play an important role in promoting growth, survival, and metastatic spread of several tumor types. AXL and MERTK are overexpressed in head and neck squamous cell carcinoma (HNSCC), triple-negative breast
Jeanne M Quinn et al.
Molecular cancer therapeutics, 18(2), 389-398 (2018-11-28)
Ovarian cancer, one of the deadliest malignancies in female cancer patients, is characterized by recurrence and poor response to cytotoxic chemotherapies. Fewer than 30% of patients with resistant disease will respond to additional chemotherapy treatments. This study aims to determine
Xiao-Han Qu et al.
Oncology letters, 10(3), 1677-1685 (2015-12-02)
Lung cancer has long been one of the most serious types of malignant tumor, and is associated with high incidence and mortality rates. Despite advancements in the comprehensive treatment of the disease, particularly with targeted therapeutic agents, there has been

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.