Passa al contenuto
Merck
Tutte le immagini(1)

Documenti fondamentali

EHU043571

Sigma-Aldrich

MISSION® esiRNA

targeting human YY1

Autenticatiper visualizzare i prezzi riservati alla tua organizzazione & contrattuali

Scegli un formato

20 μG
193,00 €
50 μG
342,00 €

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.
Tutte le immagini(1)

Scegli un formato

Cambia visualizzazione
20 μG
193,00 €
50 μG
342,00 €

About This Item

Codice UNSPSC:
41105324
NACRES:
NA.51

193,00 €

Per informazioni sulla disponibilità, contatta il Servizio Clienti.

Descrizione

Powered by Eupheria Biotech

Nome Commerciale

MISSION®

Stato

lyophilized powder

Sequenza bersaglio del cDNA di esiRNA

GTCACCATGTGGTCCTCAGATGAAAAAAAAGATATTGACCATGAGACAGTGGTTGAAGAACAGATCATTGGAGAGAACTCACCTCCTGATTATTCAGAATATATGACAGGAAAGAAACTTCCTCCTGGAGGAATACCTGGCATTGACCTCTCAGATCCCAAACAACTGGCAGAATTTGCTAGAATGAAGCCAAGAAAAATTAAAGAAGATGATGCTCCAAGAACAATAGCTTGCCCTCATAAAGGCTGCACAAAGATGTTCAGGGATAACTCGGCCATGAGAAAACATCTGCACACCCACGGTCCCAGAGTCCACGTCTGTGCAGAATGTGGCAAAGCTTTTGTTGAGAGTTCAAAACTAAAACGACACCAACTGGTTCATACTGGAGAGAAGCCCTTTCAGTGCA

N° accesso Ensembl | uomo

ENSG00000100811

N° accesso NCBI

NM_003403

Condizioni di spedizione

ambient

Temperatura di conservazione

−20°C

Informazioni sul gene

human ... YY1(7528) , YY1(7528)

Descrizione generale

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Note legali

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Codice della classe di stoccaggio

10 - Combustible liquids

Punto d’infiammabilità (°F)

Not applicable

Punto d’infiammabilità (°C)

Not applicable

Scegli una delle versioni più recenti:

Certificati d'analisi (COA)

Lot/Batch Number
DCV
VUU
MUU
SSU
ISU

Non trovi la versione di tuo interesse?

Se hai bisogno di una versione specifica, puoi cercare il certificato tramite il numero di lotto.

Cerca un COA

Possiedi già questo prodotto?

I documenti relativi ai prodotti acquistati recentemente sono disponibili nell’Archivio dei documenti.

Visita l’Archivio dei documenti

J-B Tian et al.
European review for medical and pharmacological sciences, 23(13), 5714-5729 (2019-07-13)
Increasing studies have confirmed long non-coding RNAs (lncRNAs) as novel regulators in tumorigenesis. LncRNA DDX11 antisense RNA 1 (DDX11-AS1) has been found to be abnormally expressed in several tumors. In this work, we aimed to evaluate its expressions and functions
Jinpiao Lin et al.
Journal of autoimmunity, 77, 67-75 (2016-11-11)
Previous studies have revealed a critical role of YY1, a "Yin Yang" transcription factor, in cancer development and progression. However, whether YY1 has any role in rheumatoid arthritis (RA) remains unknown. This study aims to explore the potential role of
Xin-Chun Zhang et al.
Biochemical and biophysical research communications, 502(2), 269-275 (2018-05-29)
Neuroinflammation plays a critical role in the process of neurodegenerative disorders, during which microglia, the principal resident immune cells in the central nervous system, are activated and produce proinflammatory mediators. Yin-Yang 1 (YY1), a multi-functional transcription factor, is widely expressed
Huan Liu et al.
Scientific reports, 10(1), 20493-20493 (2020-11-26)
Angiogenesis is a physiological process for the formation of new blood vessels from the pre-existing vessels and it has a vital role in the survival and growth of neoplasms. During tumor angiogenesis, the activation of the gene transcriptions in vascular
Yan Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 84, 1274-1281 (2016-11-05)
The microRNAs represent a class of noncoding RNAs with short length and play diverse roles in many biological processes. Despite tremendous effects have been devoted, the role of miR-635 in non-small cell lung cancer (NSCLC) remains elusive. Here we report
Visualizza tutti i documenti correlati

Domande

Recensioni

Nessuna valutazione

Filtri attivi

Il team dei nostri ricercatori vanta grande esperienza in tutte le aree della ricerca quali Life Science, scienza dei materiali, sintesi chimica, cromatografia, discipline analitiche, ecc..

Contatta l'Assistenza Tecnica.