Ugrás a tartalomra
Merck

EHU002001

Sigma-Aldrich

MISSION® esiRNA

targeting human HDAC2

Bejelentkezésa Szervezeti és Szerződéses árazás megtekintéséhez


About This Item

UNSPSC kód:
41105324
NACRES:
NA.51

leírás

Powered by Eupheria Biotech

Minőségi szint

termékcsalád

MISSION®

Forma

lyophilized powder

esiRNS cDNS célszekvencia

CAGTTGCTGGAGCTGTGAAGTTAAACCGACAACAGACTGATATGGCTGTTAATTGGGCTGGAGGATTACATCATGCTAAGAAATCAGAAGCATCAGGATTCTGTTACGTTAATGATATTGTGCTTGCCATCCTTGAATTACTAAAGTATCATCAGAGAGTCTTATATATTGATATAGATATTCATCATGGTGATGGTGTTGAAGAAGCTTTTTATACAACAGATCGTGTAATGACGGTATCATTCCATAAATATGGGGAATACTTTCCTGGCACAGGAGACTTGAGGGATATTGGTGCTGGAAAAGGCAAATACTATGCTGTCAATTTTCCAATGAGAGATGGTATAGATGATGAGTCATATGGGCAGATATTTAAGCCTATTATCTCAAAGGTGATGGAGATGTATCAACCTAGTGCTGTGGTATTACAGTGTGGTGCAGA

Ensembl | humán elérési szám

NCBI elérési szám

kiszállítva

ambient

tárolási hőmérséklet

−20°C

Géninformáció

Általános leírás

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Jogi információk

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Tárolási osztály kódja

10 - Combustible liquids

Lobbanási pont (F)

Not applicable

Lobbanási pont (C)

Not applicable


Válasszon a legfrissebb verziók közül:

Analitikai tanúsítványok (COA)

Lot/Batch Number

Nem találja a megfelelő verziót?

Ha egy adott verzióra van szüksége, a tétel- vagy cikkszám alapján rákereshet egy adott tanúsítványra.

Már rendelkezik ezzel a termékkel?

Az Ön által nemrégiben megvásárolt termékekre vonatkozó dokumentumokat a Dokumentumtárban találja.

Dokumentumtár megtekintése

Ziran Wang et al.
Molecular therapy oncolytics, 17, 547-561 (2020-07-09)
Hepatocellular carcinoma (HCC) is a common malignant tumor. LukS-PV is the S component of Panton-Valetine leukocidin (PVL), which is secreted by Staphylococcus aureus. This study investigated the effects of LukS-PV on the proliferation, apoptosis, and cell-cycle progression of HCC cells
Jie Gao et al.
Gene, 678, 1-7 (2018-08-01)
Chronic diabetic foot ulcer (DFU) is a major cause of disability and mortality in patients with diabetes. Dysfunctional endothelial progenitor cells (EPCs) play important roles in preventing vascular complications in these patients. Our results determined the elevated expression of histone
Wen-Feng Fang et al.
Journal of inflammation (London, England), 15, 3-3 (2018-01-19)
Sepsis is a life-threatening organ dysfunction caused by dysregulated host response to infection, and is primarily characterized by an uncontrolled systemic inflammatory response. In the present study, we developed an effective adjunct therapy mediated by a novel mechanism, to attenuate
Shenglei Li et al.
Oncology letters, 13(1), 403-409 (2017-01-27)
Increasing evidence has demonstrated that histone deacetylase 2 (HDAC2) participates in the regulation of a variety of biological processes in numerous tumors. However, the potential role of HDAC2 in the development and progression of esophageal squamous cell carcinoma (ESCC) remains
David B Wang et al.
Brain pathology (Zurich, Switzerland), 29(2), 164-175 (2018-07-22)
Histone deacetylases (HDACs) catalyze acetyl group removal from histone proteins, leading to altered chromatin structure and gene expression. HDAC2 is highly expressed in adult brain, and HDAC2 levels are elevated in Alzheimer's disease (AD) brain. We previously reported that neuron-specific

Tudóscsoportunk valamennyi kutatási területen rendelkezik tapasztalattal, beleértve az élettudományt, az anyagtudományt, a kémiai szintézist, a kromatográfiát, az analitikát és még sok más területet.

Lépjen kapcsolatba a szaktanácsadással