Přejít k obsahu
Merck
Všechny fotografie(1)

Key Documents

EHU107101

Sigma-Aldrich

MISSION® esiRNA

targeting human PPIA

Přihlásitk zobrazení cen stanovených pro organizaci a smluvních cen
Všechny fotografie(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGGTGTTTGGCAAAGTGAAAGAAGGCATGAATATTGTGGAGGCCATGGAGCGCTTTGGGTCCAGGAATGGCAAGACCAGCAAGAAGATCACCATTGCTGACTGTGGACAACTCGAATAAGTTTGACTTGTGTTTTATCTTAACCACCAGATCATTCCTTCTGTAGCTCAGGAGAGCACCCCTCCACCCCATTTGCTCGCAGTATCCTAGAATCTTTGTGCTCTCGCTGCAGTTCCCTTTGGGTTCCATGTTTTCCTTGTTCCCTCCCATGCCTAGCTGGATTGCAGAGTTAAGTTTATGATTATGAAATAAAAACTAAATAACAATTGTCCTCGTTTGAGTTAAGAGTGTTGATGTAGGCTTTATTTTAAGCAGTAATGGGTTACTTCTGAAACATCACTTGTTTGCTTAATTCTACACAGTACTTAGATTTTTTTTACTTTCCAGTCCCAGGAAGTGTCAATGTTTGTTGAGTGGAATATTGAAAATGTAGGCAGCAACTGGG

Ensembl | human accession no.

ENSG00000196262

NCBI accession no.

NM_021130

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PPIA(5478) , PPIA(5478)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Osvědčení o analýze (COA)

Vyhledejte osvědčení Osvědčení o analýze (COA) zadáním čísla šarže/dávky těchto produktů. Čísla šarže a dávky lze nalézt na štítku produktu za slovy „Lot“ nebo „Batch“.

Již tento produkt vlastníte?

Dokumenty související s produkty, které jste v minulosti zakoupili, byly za účelem usnadnění shromážděny ve vaší Knihovně dokumentů.

Navštívit knihovnu dokumentů

Hiroya Fujioka et al.
Oncology letters, 13(1), 289-295 (2017-01-27)
Paclitaxel is widely used to treat various cancers; however, resistance to this drug is a major obstacle to breast cancer chemotherapy. To identify the proteins involved in paclitaxel resistance, the present study compared the proteomes of MCF-7 human breast cancer
N Doti et al.
Cell death & disease, 5, e993-e993 (2014-01-18)
Delayed neuronal cell death largely contributes to the progressive infarct development and associated functional impairments after cerebral ischemia or brain trauma. Previous studies exposed a key role for the interaction of the mitochondrial protein apoptosis-inducing factor (AIF) and cytosolic cyclophilin
Huan Zhang et al.
PloS one, 9(3), e92824-e92824 (2014-03-26)
Hypoxia-inducible factor-1α (HIF-1α) is a highly important transcription factor involved in cell metabolism. HIF-1α promotes glycolysis and inhibits of mitochondrial respiration in pancreatic ductal adenocarcinoma (PDAC). In response to tumor hypoxia, cyclophilin A (CypA) is over-expressed in various cancer types
Hiroaki Takeuchi et al.
Retrovirology, 9, 3-3 (2012-01-10)
An understanding of host cell factors that affect viral replication contributes to elucidation of the mechanism for determination of viral tropism. Cyclophilin A (CypA), a peptidyl-prolyl cis-trans isomerase (PPIase), is a host factor essential for efficient replication of human immunodeficiency
Artur Kaul et al.
PLoS pathogens, 5(8), e1000546-e1000546 (2009-08-15)
Viruses are obligate intracellular parasites and therefore their replication completely depends on host cell factors. In case of the hepatitis C virus (HCV), a positive-strand RNA virus that in the majority of infections establishes persistence, cyclophilins are considered to play
Zobrazit všechny související dokumenty

Náš tým vědeckých pracovníků má zkušenosti ve všech oblastech výzkumu, včetně přírodních věd, materiálových věd, chemické syntézy, chromatografie, analytiky a mnoha dalších..

Obraťte se na technický servis.